close

Anmelden

Neues Passwort anfordern?

Anmeldung mit OpenID

GGA- Proteine und ihr Einfluss auf den BACE Transport in der

EinbettenHerunterladen
Universitätsklinikum Ulm
Klinik für Neurologie
Ärztlicher Direktor: Professor Dr. A.C. Ludolph
GGA- Proteine und ihr Einfluss auf den BACE
Transport in der Alzheimer Erkrankung
Dissertation zur Erlangung des Doktorgrades der Medizin
der Medizinischen Fakultät der Universität Ulm
Cornelia Steinmetz
Freiburg
Im Jahr 2009
Amtierender Dekan: Prof. Dr. Klaus- Michael Debatin
1. Berichterstatter: Prof. Dr. von Arnim
2.Berichterstatter: Prof. Dr. Kirchheiner
Tag der Promotion: 24.06.2010
Inhaltsverzeichnis
___________________________________________I _
Abkürzungsverzeichnis ...................................................................................... III
1
Einleitung ........................................................................................................ 1
1.1 Die Alzheimer Erkrankung ............................................................................ 1
1.1.1 Epidemiologie......................................................................................... 1
1.1.2 Pathologie .............................................................................................. 1
1.1.3 Risikofaktoren ........................................................................................ 2
1.1.4 Diagnose ................................................................................................ 2
1.1.5 Therapie ................................................................................................. 3
1.2 Plaques und Tangles .................................................................................... 4
1.2.1 Plaques .................................................................................................. 5
1.2.2 Tangles .................................................................................................. 5
1.3 Relevante Proteine ....................................................................................... 6
1.3.1 Amyloid Precursor Protein...................................................................... 6
1.3.2 Sekretiertes Amyloid Precursor Protein α............................................... 6
1.3.3 Amyloid β ............................................................................................... 8
1.3.4 β-Sekretase.......................................................................................... 11
1.3.5 Familie der GGAs................................................................................. 12
1.4 Transportwege und Interaktionen ............................................................... 16
1.5 Zielsetzung ................................................................................................. 19
2
Material und Methoden.................................................................................. 21
2.1 Material ....................................................................................................... 21
2.2 Methoden.................................................................................................... 27
2.2.1 DNA-Methoden .................................................................................... 27
2.2.2 Zellkultur-Methoden.............................................................................. 32
2.2.3 Konfokale Laserscanning Mikroskopie ................................................. 34
2.2.4 FRET/FLIM/SLIM ................................................................................. 36
2.2.5 Einstellung der Apparaturen................................................................. 40
2.2.6 Auswertung der SLIM Daten mit SPCImage ........................................ 40
2.3 Statistische Methoden................................................................................. 41
3
Ergebnisse .................................................................................................... 43
3.1 Ergebnisse Konfokale Laserscanning Mikroskopie..................................... 43
3.2 Ergebnisse Spektrales Fluorescence Lifetime Imaging .............................. 54
3.2.1 Fokus auf GGA-Proteine und ihre VHS-Domäne ................................. 54
Inhaltsverzeichnis
___________________________________________II _
3.2.2 Fokus auf BACE und das DXXLL-Motiv ............................................... 66
4
Diskussion..................................................................................................... 77
4.1 Material und Methoden ............................................................................... 77
4.1.1 Zellmodell............................................................................................. 77
4.1.2 Transfektion ......................................................................................... 78
4.1.3 Konfokale Laserscanning Mikroskopie ................................................. 78
4.1.4 FRET/FLIM/SLIM ................................................................................. 80
4.2 Ergebnisse.................................................................................................. 83
4.2.1 Lokalisation .......................................................................................... 83
4.2.2 Interaktion von BACE mit den GGAs.................................................... 84
4.2.3 Interaktionen/Transportwege................................................................ 87
4.3 Ausblicke in der Forschung......................................................................... 88
4.4 Ausblicke in der Therapie ........................................................................... 89
4.5 Schlussfolgerung ........................................................................................ 91
5
Zusammenfassung........................................................................................ 92
6
Literaturverzeichnis ....................................................................................... 94
Abbildungsverzeichnis................................................................................. 105
Tabellenverzeichnis .................................................................................... 107
Danksagung ................................................................................................ 108
Lebenslauf................................................................................................... 109
Abkürzungsverzeichnis___________________________________________III _
Abkürzungsverzeichnis
Aβ
Amyloidβ
AD
Alzheimer’s Disease
ADAM
A Disintegrin And Metalloprotease
ADC
Analog Digital Converter
ADP
Adenosindiphosphat
AICD
Amyloid Precursor Protein Intrazelluläre Domäne
Aph1
Anterior Pharynx Defective 1
APLP
Amyloid Precursor Like Protein
ApoE4
Apolipoprotein E4
APP
Amyloid Precursor Protein
ARF
ADP Ribosylation Factor
BACE
β-site of APP-Cleaving Enzyme
Bp
Basenpaare
BP
Bandpassfilter
BSA
Bovine Serum Albumin
C83
Carboxy terminales 83 Aminosäuren Fragment
C99
Carboxy terminales 99 Aminosäuren Fragment
CERAD
Consortium to Establish a Registry for AD
CFD
Constant Fraction Discriminator
CLSM
Confocal Laserscanning Microscopy
CMV
Cytomegalievirus
CT
Computertomographie
CTF
Carboxy Terminales Fragment
DMEM
Dulbecco’s Modified Eagle Medium
DNA
Desoxyribonucleic Acid
dsDNA
Doppelsträngige DNA
E.coli
Eschericia coli
EDTA
Ethylendiamintetraacetat
EGF
Epidermal Growth Factor
EGFP
Enhanced Green Fluorescent Protein
ER
Endoplasmatisches Retikulum
Abkürzungsverzeichnis___________________________________________IV _
FLIM
Fluorescence Lifetime Imaging
FRET
Förster Resonance Energy Transfer
GAE
γ-Adapting Ear, Domäne der GGAs
GAT
GGA and Tom, Domäne der GGAs
GGA
Golgi-localized, γ-ear-containing, ARF-binding
Protein
Hrs
Hepatocyte Growth Factor Receptor Substrate
Kd
Bindungskonstante
KanR
Kanamycin Resistenz
LB
Lysogey Broth
LP
Langpassfilter
LR
Lipoprotein Rezeptor
LRP
Lipoprotein Rezeptor Protein
LSM
Laserscanning Mikroskop
M
Molar
META
Metatracking
mM
Milimolar
MMST
Minimal Mental State Test
mRFP
Monomeric Red Fluorescent Protein
MRT
Magnetresonanztomographie
n
Anzahl (Statistik)
N-terminal
Amino-terminal
NCS
Newborn Calf Serum
NeoR
Neomycin Resistenz
p
Probability (Statistik)
PCR
Polymerase Chain Reaction
Pen2
Presenilin Enhancer 2
PET
Positronen Emissions Tomographie
PKA
Protein Kinase A
PKC
Protein Kinase C
PMT
Photon Multiplier Tube
PP
Protein Phosphatase
ps
Pikosekunden
Abkürzungsverzeichnis___________________________________________V _
pUC ori
Plasmid University of California origin
RFP
Red Fluorescent Protein
RNA
Ribonucleic Acid
RNAi
Inhibitorische RNA
RPMI
entwickelt im Roswell Park Memorial Institute
RT
Raumtemperatur
sAPPα
Sekretiertes APPα
SLIM
Spectral Lifetime Imaging Microscopy
SorLA
Sorting Lipoprotein Rezeptor Analogon,
SPC
Single Photon Counting
SPECT
Single Photon Emission Computer Tomography
STAM
Signal Transducing Adaptor Molecule
tm
Tau mean (mittlere Abklingzeit eines Fluorophors)
TAC
Time to Amplitude Converter
TCSPC
Time Correlated Single Photon Counting
TD
Terminale Domäne
TGN
Trans-Golgi-Network
Tom
Target of Myeloblastosis
Tris
Tris (Hydroxymethyl)-Aminomethan
UV
Ultraviolett
VHS
Vps-Hrs-STAM-Domäne der GGAs
Vps
Vacuolar Protein Sorting
1 Einleitung
1
1 Einleitung
1.1 Die Alzheimer Erkrankung
1.1.1 Epidemiologie
Die Alzheimer Erkrankung (Morbus Alzheimer, Alzheimer’s disease) ist in den
westlichen Industriestaaten mit einer Prävalenz zwischen 6 und 9% bei den über
65jährigen die häufigste Form der Demenzerkrankung, gefolgt von der vaskulären
Demenz (Bickel 2000). In Deutschland leiden über eine Millionen Menschen an
einer Demenzerkrankung, davon sind circa 700.000 von der Alzheimer Demenz
betroffen. Von den jährlich auftretenden 200.000 Neuerkrankungen an Demenz
zählen 125.000 (62,5%) zur Demenz vom Alzheimer Typ. Entsprechend den
Vorraussagen hinsichtlich der Bevölkerungsentwicklung in Deutschland wird von
einer Verdoppelung auf zwei Millionen Betroffene bis zum Jahre 2050 gerechnet
(Bickel 2001). Es wird die familiäre Form von der sporadischen Form der
Alzheimer Demenz unterschieden. Die familiäre Form, die sich außer der
genetischen Disposition (Mutationen des Amyloid Precursor Proteins, Presenilin 1
und Presenilin 2 (Levy-Lahad et al. 1995; Hardy 1997)) durch einen Beginn der
Erkrankung vor dem 65ten Lebensjahr auszeichnet, ist für weniger als 3% aller
Erkrankungen verantwortlich (Bickel 2000).
1.1.2 Pathologie
Die neurodegenerative Erkrankung zeichnet sich psychopathologisch durch eine
im Vordergrund stehende Verschlechterung des Gedächtnisses, der Sprache, der
Orientierung und des Urteilsvermögens aus. Zusätzlich kommt es in vielen Fällen
zu einer depressiven Verstimmung, die nicht selten der Grund für eine
Erstkonsultation ist. Diese Beeinträchtigungen schränken die selbständige
Lebensführung der Patienten massiv und auf Dauer ein. Die Angaben zur
mittleren Überlebenswahrscheinlichkeit schwanken zwischen 3,3 und 6,6 Jahren
nach Erstdiagnose (Wolfson et al. 2001; Larson et al. 2004), wobei es zu hohen
individuellen Unterschieden kommt. Hier spielen vor allem ethnische Zugehörigkeit
und Komorbiditäten wie Diabetes und Hypertonus eine wichtige Rolle (Helzner et
al. 2008).
1 Einleitung
2
1.1.3 Risikofaktoren
Der bedeutendste Risikofaktor für die sporadische Form der Alzheimer
Erkrankung ist das Alter. Die Häufigkeit der Erkrankung verdoppelt sich mit jeden
zusätzlichen fünf Lebensjahren von 1,2% in der Altersgruppe der 65-70jährigen
bis auf 23,9% bei den 85-90jährigen (Bickel 2000). Als weiterer gesicherter
Risikofaktor wird die Homozygotie für das Lipoprotein ApoE4 angesehen (Kivipelto
et al. 2008).
Weitere Einflüsse wie ein niedriges Bildungsniveau, wenig geistige, soziale und
sportliche Aktivität, ein Schädel-Hirn-Trauma, Alkoholkonsum, hochkalorische und
fettreiche Nahrung sowie kardiovaskuläre Risikofaktoren (zum Beispiel Nikotin,
Hypertonie, Diabetes Mellitus und erhöhtes LDL-Cholesterin, die bei der
vaskulären Form der Demenz zur Entstehung beitragen) werden bei der
Entstehung der Alzheimer Erkrankung immer wieder diskutiert. In einer Studie
zeigten Kivipelto et al. 2008, dass die vermuteten Risikofaktoren, die zur
Entwicklung einer Demenz führen können, vor allem eine signifikante Erhöhung
des Risikos bei Menschen mit ApoE4 Homozygotie darstellen. Für sich
genommen scheinen die sogenannten Lifestyle Faktoren zwar auch eine leichte
Risikoerhöhung darzustellen, aber ein erheblicher Einfluss lässt sich nur im
Zusammenhang mit der genetischen Disposition für ApoE4 beobachten.
1.1.4 Diagnose
Diagnostiziert wird die Demenz vom Alzheimer Typ zunächst durch den
Ausschluss einer anderen organischen Ursache für den Gedächtnisverlust. Dazu
zählen unter anderem ein Schädel-Hirn-Trauma, vaskuläre Ursachen wie ein
Schlaganfall, Exsikkose oder eine Tumorerkrankung des Gehirns. Des Weiteren
spielen die Ergebnisse verschiedener neuropsychologischer Testverfahren, eine
wichtige Rolle in der Diagnostik. Häufig können zusätzlich charakteristische
Protein-Konstellationen, eine Erhöhung des Tau-Proteins und ein Absinken der Aβ
Konzentration, im Liquor des Patienten festgestellt werden (Delank und Gehlen
2006).
Ein bildgebendes Verfahren wie ein Computertomogramm (CT) oder eine
Magnetresonanztomographie (MRT) wird vor allem zum Ausschluss anderer
Krankheitsursachen benutzt. Im Verlauf der Alzheimer Erkrankung lassen sich
1 Einleitung
3
jedoch im MRT Befunde darstellen, die mit dem psychopathologischen Befund
korrellieren.
Als Ergänzung kann auch eine Kombination aus Positronen Emissions
Tomographie (PET) und CT durchgeführt werden. Dadurch kann eine verminderte
Aufnahme eines radioaktiv markierten Stoffes wie Glukose in den betroffenen
Hirnarealen nachgewiesen werden. Auch mithilfe einer Single Photon Emission
Computer
Tomographie
Veränderungen
wie
(SPECT)
eine
geringe
Untersuchung
Durchblutung
können
und
ein
pathologische
herabgesetzter
Zellstoffwechsel in einem von Alzheimer betroffenen Gehirn dargestellt werden.
Die PET und SPECT Methoden sind aufgrund der erheblichen Kosten und der
beschränkten Verfügbarkeit noch nicht als diagnostische Kriterien in den Leitlinien
erfasst, können aber im Einzelfall als ergänzende Untersuchungen eingesetzt
werden und den diagnostischen Prozess vorantreiben.
1.1.5 Therapie
Die Therapie der Erkrankung ist eine supportive Therapie, die aus der
Psychoedukation des Patienten und dessen Angehörigen, einem regelmäßigen
kognitiven Training und unterstützender Sozial- und Psychotherapie besteht.
Medikamentös wird die Alzheimer Erkrankung mit den AcetylcholinesteraseInhibitoren Donepezil, Rivastigmin und Galantamin behandelt. Diese Pharmaka
können den Verlauf der Erkrankung durch eine Erhöhung des Acetylcholin im
synaptischen Spalt verlangsamen und das geistige Niveau des Patienten für
einige Zeit konstant halten. Sie gehören zur Standardtherapie, deren Wirksamkeit
in zahlreichen Studien gezeigt wurde, die von den Krankenkassen zugelassen ist
und die vom Institut für Qualität und Wirtschaftlichkeit im Gesundheitswesen in
deren Leitlinien aufgeführt wird. Auch Glutamat-Antagonisten wie Memantine
werden bei fortgeschrittenen Formen der Alzheimer Erkrankung eingesetzt.
Memantine hat einen kleinen symptomatischen Effekt nach einer sechsmonatigen
Behandlung bei mittlerer bis schwerer Alzheimer Erkrankung. Bei Patienten mit
leichter bis mittlerer Demenz war der positive Effekt auf die Kognition erkennbar
(McShane et al. 2006; Bakchine und Loft 2008).
Antioxidantien
als
pharmakologische
Interventionsmöglichkeit
bei
neurodegenerativen Erkrankungen scheinen vielversprechend hinsichtlich ihrer
neuroprotektiven Wirkung (Wang et al. 2006). Eine Metaanalyse von Studien von
1 Einleitung
4
1966 bis März 2005 zeigte, dass aufgrund des Mangels an prospektiven,
randomisierten und kontrollierten Studien, diese Antioxidantien für eine Primärund Sekundärprävention der Alzheimer Erkrankung nicht empfohlen werden
können (Boothby und Doering 2005).
Durch die entzündliche Komponente der Alzheimer Erkrankung gehen viele
Studien
auch
in
die
Richtung
der
Verwendung
von
Antientzündlichen
Medikamenten zur Therapie der Demenz (Eikelenboom et al. 2006). Auch hier
kann die Datenlage nicht überzeugen. Krankheitsmodifizierende Medikamente wie
γ-Sekretase-Inhibitoren und eine Immunisierung mit Aβ stehen im Fokus der
aktuellen Forschung und sollen in der Diskussion dieser Arbeit beleuchtet werden.
1.2 Plaques und Tangles
Nach dem Tode eines an Alzheimer erkrankten Menschen lassen sich im Gehirn
zusätzlich zu der bereits beschriebenen makroskopischen Degeneration auch
mikroskopisch charakteristische Veränderungen gegenüber einem gesunden
Organ feststellen (Abb.1).
a
b
Abb. 1: Schematische Darstellung von Plaques und Tangles (American Health Assistance
Foundation, www.ahaf.org/alzdis/about/plaques_tangles.jpg)
a: Gesunde Neurone
b: Erkrankte Neurone mit intrazellulären neurofibrillären Tangles (neurofibrillary tangles) und Amyloid Plaques
1 Einleitung
5
1.2.1 Plaques
Als Plaques bezeichnet man extrazelluläre Ablagerungen aus aggregiertem
Amyloidβ-Peptid (Aβ). Dieses entsteht aus dem Amyloid Precursor Protein (APP)
durch eine sequentielle Proteolyse durch das β-site of APP-cleaving enzyme
(BACE) und der γ-Sekretase (Hussain et al. 1999; Sinha et al. 1999; Sinha und
Lieberburg 1999; Vassar et al. 1999; Wolfe et al. 1999; Yan et al. 1999; Lin et al.
2000; Xia et al. 2000; Wolfe und Kopan 2004). Die Plaques, die teilweise auch in
nicht an Alzheimer erkrankten Menschen gefunden werden können, sind mit einer
reduzierten Anzahl an Synapsen und zerstörten Neuriten assoziiert. Vor allem
Neurone, die Acetylcholin als Neurotransmitter benutzen, sind von dieser
Degeneration betroffen.
Die extrazellulären Aβ-Oligomere sind vermutlich neurotoxisch und wirken nach
der modifizierten Amyloidhypothese sowohl direkt als auch indirekt destruierend
(Hardy 1997). Dies geschieht wahrscheinlich durch eine Erhöhung der
Empfindlichkeit der Zellen gegenüber oxidativem und metabolischem Stress
(Mattson 2004).
Die Apolipoproteinform E4 (ApoE4), die als Risikofaktor für die Demenz vom
Alzheimer Typ gilt, fördert das Prozessieren von APP, verstärkt die Aggregation
von Aβ und erhöht den oxidativen Stress der Neurone (Mattson 2004). Die
homozygote Form des ApoE4 scheint die Denaturierung des akkumulierten Aβ zu
verhindern und die Bildung von extrazellulären fibrillären Ablagerungen zu
verstärken. Sie führt so zu einem erhöhten Risiko, eine Demenz vom Alzheimer
Typ zu entwickeln (LaDu et al. 1994; Holtzman et al. 2000).
1.2.2 Tangles
Als Tangles bezeichnet man die intrazellulären fibrillären Ablagerungen, die man
häufig mikroskopisch in Gehirnschnitten von Alzheimer Patienten finden kann. Sie
bestehen aus Aggregaten des mit Mikrotubuli assoziierten Proteins Tau, welches
durch Oxidations- und Phosphorylierungsprozesse verändert wurde. Durch den
Verlust dieses Proteins wird auch die Funktionalität der Mikrotubuli in der Zelle
eingeschränkt, was bis zum Zelltod führen kann. In Liquorproben von
Alzheimerpatienten findet man gehäuft eine Erhöhung des Protein Tau, was auf
die degenerativen Prozesse der Neurone hinweist (Delank und Gehlen 2006).
1 Einleitung
6
Das Tau-Protein stabilisiert Mikrotubuli und wird im Rahmen der Alzheimer
Erkrankung hyperphosphoryliert. Dadurch kommt es einerseits zu einem Verlust
der stabilisierenden Funktion, aber auch zu einer toxischen Funktion. Die von dem
pathologischen Tau-Protein betroffenen Neurone reagieren, indem sie vermehrt
Tau synthetisieren und das abnormale Protein in polymere Strukturen wie den
neurofibrillären Tangles zusammenlagern.
1.3 Relevante Proteine
1.3.1 Amyloid Precursor Protein
Das Amyloid Precursor Protein (APP) ist ein ubiquitär vorhandenes Typ 1
membrandurchspannendes Protein mit einem extrazellulär gelegenen N-Terminus
und einem intrazellulären C-Terminus.
Die Anzahl der APP-Moleküle in einer Zelle ist abhängig von ihrem
Entwicklungsgrad und physiologischen Status. Die genetische Information von
APP liegt auf dem Chromosom 21, was die Entwicklung einer Demenz bei
Menschen mit Down-Syndrom (Trisomie 21) erklären könnte. Lokalisiert ist APP
vor allem an der Zelloberfläche und der luminalen Seite des Endoplasmatischen
Retikulums und des Golgi-Apparates. Es existieren Isoformen von 695 bis 770
Aminosäuren, wobei im Gehirn vor allem die Isoform 695 dominiert (Mattson
2004). Die physiologische Funktion von APP ist noch nicht geklärt, es werden die
Regulation von neuronalem Überleben und Wachstum, synaptische Plastizität,
Zell-Adhäsion und Signaltransduktion diskutiert. APP wird an Axonen entlang bis
zum präsynaptischen Spalt transportiert, weshalb besonders die Synapsen für
eine Aggregation von Aβ gefährdet sind.
Die Forschung nach Interaktionspartnern von APP ist sehr aktiv, vor allem
Proteine der Low-density Lipoprotein Rezeptor Familie wie zum Beispiel LRP,
LRPI B, SorLA/LRII und Apolipoprotein Rezeptor 2 sind dafür bekannt, dass sie
mit APP interagieren und seinen endozytotischen Transport regulieren (Cam und
Bu 2006; Spoelgen et al. 2006).
1.3.2 Sekretiertes Amyloid Precursor Protein α
APP kann zwei mögliche Wege der Prozessierung durchlaufen. Die sogenannte
nicht-amyloidogene Prozessierung, die in einem gesunden Gehirn überwiegt,
1 Einleitung
7
beginnt mit der α-Sekretase. Dieses Enzym wurde nicht als ein einziges Protein
identifiziert, sondern es werden einige Proteine in Betracht gezogen, die als αSekretase fungieren könnten. Besonders die Mitglieder der “a disintegrin and
metalloprotease“
(ADAM)
Familie,
die
membrangebundene
Zelloberflächenproteine sind, scheinen die Aktivität einer α-Sekretase zu besitzen.
Da diese Aktivität durch Metall-Ionen modulierbar ist, könnten ADAM9, ADAM10
und ADAM17 mögliche α-Sekretasen sein (Asai et al. 2003).
Die α-Sekretase schneidet APP in ein 83 Aminosäuren-C-Terminus (C83) und das
sogenannte sekretierte Amyloid Precursor Protein α (sAPPα). Der entstandene
C83-Terminus wird auch als Carboxyl-Terminus-Fragment-α bezeichnet und
verbleibt membranassoziiert.
Dieser nicht sekretierte Teil des APPs wird im nächsten Schritt von der γSekretase geschnitten und resultiert in einem kleinen p3 Fragment (Aminosäuren
17-42) und der APP-Intrazellulären-Domäne (AICD) (Abb.2).
APP
C
N
α
CTFα
sAPPα
(C83)
AICD
p3
γ
Intrazellulär
Membran
Extrazellulär
Abb. 2: Die nicht amyloidogene Prozessierung des Amyloid Precursor Proteins
Das Amyloid Precursor Protein (APP) mit seinem intrazellulären Carboxyl-Terminus (C) und seinem
extrazellulären Amino-Terminus (N) wird von der α-Sekretase (α) in das sekretierte APPα (sAPPα) und das
Carboxy-Terminale-Fragment-α (CTFα), das auch als C83 bezeichnet wird, zerlegt. Die γ-Sekretase (γ)
schneidet das CTFα anschließend in ein p3 Fragment (Aminosäuren 17 bis 42) und die Amyloid Precursor
Protein Intrazelluläre Domäne (AICD).
1 Einleitung
8
Für das C-terminale AICD-Fragment wurden einige Interaktionspartner entdeckt,
besonders solche Proteine, die an das dort vorhandene NPXY-Motiv (Asparagin,
Prolin, beliebige Aminosäure, Tyrosin) binden (Trommsdorff et al. 1998). Das
NPXY-Motiv wurde als durch die Evolution konserviertes Protein-Signal
identifiziert, dass für die Sortierung von Proteinen durch Clathrin-Vesikel
verantwortlich ist (Chen et al. 1990). Durch die Clathrin-Vesikel wird das APP
durch die Zelle transportiert, vor allem von der Zelloberfläche zu den Endosomen.
Die Funktion von sAPPα ist noch nicht geklärt, aber es wird die Regulation der
neuronalen Erregbarkeit, eine Verstärkung der neuronalen Plastizität und eine
Resistenzerhöhung gegen oxidativen Stress diskutiert (Young-Pearse et al. 2008).
Die Konzentration von sAPPα steigt bei elektrischer Aktivität (Gehirnleistungen)
und bei Aktivität der Acetylcholinrezeptoren an. Bei Alzheimer Patienten ist die
Konzentration von sAPPα im Gehirn erniedrigt (Mattson 2004).
1.3.3 Amyloid β
Der zweite Weg der Prozessierung von APP nennt sich amyloidogen und erfolgt
durch zwei Enzyme (Abb.3). Zunächst schneidet das β-site of APP-cleaving
enzyme (β-Sekretase, Memapsin 2, BACE) APP in ein 99 Aminosäuren-CTerminus und das sekretierte Amyloid Precursor Protein β (sAPPβ). Der aus 99
Aminosäuren bestehende Teil wird durch die γ-Secretase weiter in zwei
Fragmente zerteilt.Die γ-Sekretase besteht aus vier Transmembranproteinen,
Nicastrin, Anterior-Pharynx-Defective 1 (Aph-1), Presenilin-Enhacer-2 (Pen-2) und
Presenilin (Takasugi et al. 2003). Das Enzym ist Mitglied der Novel Polytopic
Aspartyl Proteasen (Haass und Steiner 2002) und schneidet seine Substrate in
der membrandurchspannenden Domäne (Francis et al. 2002). Es entsteht ein
intrazellulärer Teil des APPs (AICD) von welchem man vermutet, dass er in den
Nukleus wandert, dort Einfluss auf die Genexpression nimmt und durch die
Induktion von Apoptose fördernden Genen den Zelluntergang auslöst (von Rotz et
al. 2004). Weiterhin entsteht das zwischen 39 und 42 Aminosäuren lange Aβ. Die
unterschiedliche
Länge
dieses
Peptids
ist
auf
die
teilweise
unpräzise
Prozessierung durch die γ-Sekretase zurückzuführen. Aβ lagert sich extrazellulär
zu Proteinaggregaten zusammen, welche die Aβ-Plaques bilden. Besonders bei
der Variante mit 42 Aminosäuren kommt es durch eine Verlängerung des
1 Einleitung
9
hydrophoben Endes zu einer Erhöhung der Aggregationsneigung und somit zu
einer vermehrten Ausbildung von Aβ-Plaques.
APP
C
N
CTFβ
sAPPβ
(C99)
β
Amyloid-β
AICD
Amyloid-β
γ
Plaque
Intrazellulär
Membran
Extrazellulär
Abb. 3: Die amyloidogene Prozessierung des Amyloid Precursor Proteins
Das Amyloid Precursor Protein (APP) mit seinem intrazellulären Carboxyl-Terminus (C) und
seinem extrazellulären Amino-Terminus (N) wird von der β-Sekretase (β) in das sekretierte APPβ
(sAPPβ) und das Carboxy-Terminale-Fragment-β (CTFβ), das auch als C99 bezeichnet wird,
zerlegt. Die γ-Sekretase (γ) schneidet das CTFβ anschließend in das Amyloid-β-Fragment und die
Amyloid Precursor Protein Intrazelluläre Domäne (AICD). Mehrere Amyloid-β-Fragmente
akkumulieren extrazellulär zu Amyloid-β-Plaques.
Bei einer Form der familiären Alzheimer Erkrankung, die autosomal dominant
vererbt wird, kommt es zum Austausch von einer oder zwei Aminosäuren in oder
in direkter Nachbarschaft der kritischen Schnittstellen des APP, was zu einer
vermehrten Prozessierung durch BACE führt und somit die Ablagerung von AβPlaques und den Verlust der kognitiven Fähigkeiten bereits in einem frühen
Lebensalter erklärt. Warum es bei der sporadischen Form der Alzheimer Demenz
auch zu diesen Phänomenen kommt, ist noch nicht geklärt.
Dem Aβ wird vor allem als Oligomer in frühen Aggregationsstadien eine toxische
Wirkung zugeschrieben. Es wirkt vermutlich über eine Behinderung von
1 Einleitung
10
synaptischen Ionen- und Glukosetransportern und setzt somit die neuronale
Plastizität herab. Eine Induktion von oxidativem Stress und eine Veränderung der
zellulären Kalzium Homöostase durch Aβ wird auch diskutiert (Mattson 2004).
Schon bevor die neurofibrillären Tangles und die Plaques entstehen, findet
oxidativer Stress in der demenziellen Entwicklung statt. Viele Makromoleküle wie
Zucker, Lipide, Proteine und Nukleinsäuren werden davon angegriffen und führen
zu neuronaler Dysfunktion. Es wurde auch postuliert, dass die Bildung von
Amyloidβ und hyperphosphoryliertem Tau-Protein und deren Ablagerungen in den
frühen Stadien der Erkrankung als kompensatorische Reaktion der Zelle dient, um
diese vor dem oxidativen Stress zu schützen (Smith et al. 2002; Castellani et al.
2006). Beim Fortschreiten der Erkrankung reicht die antioxidative Wirkung dieser
Ablagerungen aber entweder nicht mehr aus, oder geht dazu über, selbst prooxidativ zu wirken und erhöht so die Produktion von schädlichen Radikalen
(Moreira et al. 2008).
Heute
zeigen
immunhistochemische
Studien,
dass
die
Amyloid-Plaques
tatsächlich mit einer großer Anzahl von Proteinen des Entzündungsprozesses
(Komplementfaktoren, Akut-Phase-Proteine und pro-inflammatorische Zytokine)
und Ansammlungen von aktivierter Mikroglia zusammengelagert sind. Diese
Beobachtungen führten zu der Ansicht, dass die Amyloid-Plaques der Nidus einer
nicht immun vermittelten chronischen Entzündungsantwort ist, welche lokal durch
eine Ablagerung von fibrillären Aβ ausgelöst wird. Neuropathologische Studien
zeigen
eine
enge
Beziehung
zwischen
fibrillären
Aβ-Ablagerungen,
Entzündungsprozessen und Neurodegeneration in frühen Stadien der Alzheimer
Erkrankung, während in den späteren Stadien die Erkrankung eher durch die
Veränderung der Gehirnstruktur durch Tau-Proteine gekennzeichnet ist (Mattson
2004).
Inwieweit die Konzentration von Aβ tatsächlich mit einem kognitiven Defizit
assoziiert werden kann, ist umstritten. Es gibt allerdings Studien, die eine starke
Korrelation festgestellt haben (Hsiao et al. 1996; Naslund et al. 2000; Gong et al.
2003).
1 Einleitung
11
1.3.4 β-Sekretase
Die β-Sekretase wurde als β-site of APP cleaving enzyme (BACE) identifiziert
(Hussain et al. 1999; Vassar et al. 1999) und ist eine Typ 1 Membran-Assoziierte
Aspartat Protease, die außer APP auch andere Proteine wie zum Beispiel Amyloid
Precursor Like Protein (APLP 1 und 2) und P-Selectin-Glykoprotein-Ligand 1
prozessiert (Wahle et al. 2005). Es existiert noch eine weitgehend homologe
β- Sekretase (BACE 2), die aber vor allem in peripheren Geweben lokalisiert ist
(Vassar et al. 1999; Bennett et al. 2000) und deshalb nicht detaillierter
beschrieben werden soll. Die Information für BACE ist auf dem Chromosom 11
lokalisiert. Es wurde eine Interaktion zwischen BACE und dem Low-density
lipoprotein receptor-related protein (LRP) festgestellt, dessen extrazelluläre
Bindungsdomänen die Endozytose von vielen Liganden beeinflusst, darunter auch
APP und Apolipoprotein E (Kounnas et al. 1995; Herz und Strickland 2001; Li et
al. 2001). BACE enthält in seiner Sequenz ein DISLL-Bindungsmotiv, wobei D
Aspartat, I Isoleucin, S Serin und L Leucin ist. Mit diesem Motiv, das am CTerminus des Proteins lokalisiert ist, kann BACE an Transportproteine binden
(Abb.4).
BACE
1
527
DISLL
496
500
Abb. 4: β-site of Amyloid Precursor Protein Cleaving Enzyme (BACE)
BACE (blau) beginnt mit seiner ersten Aminosäure (1) am Aminosäure-Terminus und endet mit Aminosäure
527 am Carboxy-Terminus, zum Zytoplasma gerichtet ist. Von Aminosäure 496 bis 500 enthält BACE das
sogenannte DISLL-Motiv (rot), welches aus den Aminosäuren Aspartat, Isoleucin, Serin und zweimal Leucin
besteht. Mit diesem Motiv kann BACE an Transportproteine binden.
Nach der während der Translation stattfindenden N-Glykosylierung kommt es zu
einer proteolytischen Entfernung der Prodomäne von BACE. Daraufhin wird das
Enzym zum Golgi-Apparat zur weiteren Prozessierung und zur Sekretion
transportiert (Bennett et al. 2000; Capell et al. 2000; Creemers et al. 2001). Die
höchste Konzentration an BACE Proteinen in der Zelle befindet sich in
1 Einleitung
12
Kompartimenten des Golgi-Apparates und den Endosomen, in denen es auch
zusammen mit APP lokalisiert ist. Die Aktivität von BACE hat ihr Optimum im
sauren pH (Sinha et al. 1999; Vassar et al. 1999; Yan et al. 1999; Lin et al. 2000).
Deshalb kommt es vor allem im Golgi-Apparat, in Endosomen und Lysosomen zur
Prozessierung der Interaktionspartner. Die physiologische Funktion von BACE ist
noch nicht geklärt, allerdings erscheinen BACE Knockout Mäuse phänotypisch als
normal und zeigen nur eine deutlich verringerte Produktion an Aβ (Roberds et al.
2001; Ohno et al. 2004; Willem et al. 2006). Aufgrund dieser Erkenntnisse, scheint
BACE zumindest bei Mäusen keine relevante physiologische Funktion zu haben,
die bei völliger Ausschaltung des Enzyms zu Problemen führen könnte, und wird
somit als vielversprechender pharmakologischer Angriffspunkt der Alzheimer
Therapie gehandelt.
BACE ist verantwortlich für die proteolytische Spaltung von APP in den sauren
Kompartimenten der Zelle (Haass et al. 1992; Koo und Squazzo 1994; Koo et al.
1996; Yamazaki et al. 1996). Nach heutigen Erkenntnissen findet sich BACE in
einem aktivierten Zustand auch an der Zelloberfläche und in Lipideinschnürungen
(Huse et al. 2000; Riddell et al. 2001; Chyung und Selkoe 2003; Kinoshita et al.
2003). Dass BACE mit APP sowohl in Endosomen, als auch an der Zelloberfläche
interagiert wurde mit der FRET-Methode, die auch in dieser Arbeit benutzt wird
von Kinoshita et al. 2003 beobachtet.
1.3.5 Familie der GGAs
Golgi-localized, γ-ear-containing, Adenosindiphosphat ribosylation factor-binding
proteins (GGAs) sind eine Familie von monomeren Adapter Proteinen, die in die
Sortierung von Transportproteinen vom TGN zu endosomalen Kompartimenten
involviert sind (Dell'Angelica et al. 2000; Hirst et al. 2000; Doray et al. 2002; Doray
et al. 2002). Bis heute sind drei verschiedene GGA Proteine bekannt (GGA1,
GGA2 und GGA3), die sich in einigen Eigenschaften unterscheiden.
Sie bestehen alle aus einer N-terminalen Vps (Vacuolar Protein Sorting), Hrs
(Hepatocyte Growth Factor Receptor Substrate) und STAM (Signal Transducing
Adaptor Molecule) (VHS) Domäne, einer GGA and Tom (Target of myeloblastosis)
(GAT) Domäne, einer variablen Hinge Region und einer γ-adapting ear (GAE)
Domäne (Abb.6). Trotz des prinzipiell gleichen Aufbaus mit den vier wichtigen
Domänen unterscheiden sich GGA1, GGA2 und GGA3 in einigen Details ihrer
1 Einleitung
13
Aminosäuresequenzen. GGA2 ist mit 615 Aminosäuren das kürzeste der drei
GGAs, hat aber die längste VHS-Domäne. GGA3 ist mit 690 Aminosäuren das
längste GGA-Protein und hat auch die längste GAT-Domäne und Hinge-Region
(Abb.5).
GGA1
VHS
GAT
1
GGA2
145
VHS
1
GGA3
1
GAT
566
Hinge
315
GAT
113
GAE
315
163
VHS
Hinge
639
GAE
525
Hinge
323
615
GAE
617
690
Abb. 5: Die drei Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factorbinding Proteine (GGA) schematisch dargestellt
Trotz prinzipiell gleichem Aufbau unterscheiden sich die GGAs in einigen Details.GGA2 ist das kürzeste GGA
mit 615 Aminosäuren, hat aber die längste VHS (Vacuolar Protein Sorting (Vps), Hepatocyte Growth Factor
Receptor Substrate (Hrs), Signal Transducing Adaptor Molecule (STAM)-Domäne (rosa).
Die GAT (GGA and Target of Myeloblastosis (Tom))-Domäne und die Hinge-Region sind bei GGA3 am
längsten, wobei GGA3 mit 690 Aminosäuren auch das längste der GGA-Proteine ist.
Die VHS Domäne bindet an DXXLL Motive in Proteinen, die zu transportieren
sind. Die GGAs erkennen diese Bindungsstelle über die dort herrschende
Oberflächenspannung, hydrophobe Aminosäuren und die komplementären HelixStrukturen. Die GAT Domäne und die prolinreiche Hinge Region binden
Adenosindiphosphat (ADP)-Ribosylations Faktoren (ARFs) und Clathrin, während
die GAE Domäne mit zusätzlichen Proteinen interagiert (Bonifacino 2004). BACE
enthält das charakteristische DXXLL Bindungsmotiv für GGAs in seiner
zytoplasmatischen Domäne und eine direkte Bindung von BACE an GGA1 konnte
gezeigt werden (He et al. 2002; He et al. 2003; Shiba et al. 2004; von Arnim et al.
2004). Eine Übersicht über den räumlichen Aufbau der GGAs und ihrer
potentiellen Bindungspartner zeigt Abb.6.
1 Einleitung
14
Protein
Abb. 6: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding
protein (GGA) und seine Domänen (Bonifacino 2004)
Gelb: GGA and Tom (Target of myeloblastosis) (GAT-Domäne), bindet Adenosindiphosphat (ADP)Ribosylations Faktoren (ARFs), und Clathrin
Grün: γ-adapting ear (GAE-Domäne), bindet ARFs, Clathrin und zusätzliche Proteine
Rosa: Vps (Vacuolar Protein Sorting), Hrs (Hepatocyte Growth Factor Receptor Substrate) und STAM (Signal
Transducing Adaptor Molecule) (VHS-Domäne), bindet Transportproteine
Rosa gestrichelt: Hinge-Domäne, bindet ARFs und Clathrin, zusätzlich Autoinhibition über eine pSLLDDFLM
(Serin, Leucin, Leucin, Aspartat, Aspartat, Phenylalanin, Leucin, Methionin)-Sequenz möglich
Bindungen mit folgenden Proteinen sind möglich:
Rot: Transportprotein (Cargo receptor)
Blau: ARF1
Lila: Clathrin, bindet mit der Terminal Domain (TD) seiner schweren Kette an eine LLDDE (Leucin, Leucin,
Aspartat, Aspartat, Glutamat)-Sequenz
Lachsfarben: Protein, kann ein ARF oder Ähnliches sein
Außer in ihrem Aufbau unterscheiden sich GGA1, GGA2 und GGA3 in einigen
weiteren Eigenschaften.
GGA1, dessen genetische Information auf Chromoson 22 lokalisiert ist, hat vier
identifizierte potentielle Phosphorylierungsstellen. S268 und T270 in der GATDomäne
und
S355
und
S480
in
der
Hinge-Domäne.
Die
Aktivierung
beziehungsweise Inaktivierung dieser Phosphorylierungsstellen kann jeweils zu
1 Einleitung
15
einer engeren Bindung an die Membranen des TGN führen, oder eine
Umverteilung von GGA1 in periphere Regionen des Zytoplasmas induzieren
(McKay und Kahn 2004). GGA1 ist das Einzige der drei GGA-Proteine, dass einen
Einfluss auf den Transportweg von Adiponectin durch die Zelle hat (Xie et al.
2006).
GGA2 unterscheidet sich durch eine offene Konformation in der VHS-Domäne von
den beiden anderen Proteinen, die eine α-helikale Struktur vorweisen. Diese
Konformation in GGA2, die flexibel ist, könnte dazu beitragen, dass sich die
Domäne an verschiedene zu transportierende Substrate anpassen kann. (Zhang
et al. 2007).
GGA3 hat fünf identifizierte potentielle Phosphorylierungsstellen, die nur teilweise
homolog zu den entsprechenden Stellen im GGA1-Protein sind (McKay und Kahn
2004). S126, S234 (homolog zu S268 in GGA1), S355, S505 und S526. Zusätzlich
wurde ein physiologischer Faktor gefunden, der eine Phosphorylierung in GGA3
herbeiführt. Der Epidermal Growth Factor (EGF) führt zu einer Phosphorylierung in
der Hinge Region von GGA3 und zu einer Konformationsänderung des Proteins,
was zu herabgesetzten Assoziation mit Membranen führt (Kametaka et al. 2005).
Des Weiteren wurden unterschiedliche Bindungskonstanten (Kd) der VHS
Domänen der drei GGA Proteine mit BACE festgestellt. In Untersuchungen der
isolierten Proteine in vitro konnten He et al. 2003 zeigen, dass eine
Phosphorylierung von BACE zu einer Abnahme der Kd der VHS Domäne um das
Zehnfache bei GGA1, das Vierfache bei GGA2 und das Vierzehnfache bei GGA3
führte. Diese Beobachtung lässt vermuten, dass die drei Proteine ein
unterschiedlich starkes Bindungsvermögen ihrer VHS Domäne gegenüber BACE
zeigen und somit verschiedene Aufgaben im Transportweg von BACE durch die
Zelle übernehmen könnten.
Sowohl GGA1 und GGA3 haben ein potentielles DXXLL-Motiv in ihrer HingeRegion. Durch Phosphorylierung eines Serin durch Proteinkinase 2 kann es zu
einer Autoinhibition kommen. Dadurch können GGA1 und GGA3 nicht mehr mit
anderen Proteinen interagieren (Doray et al. 2002).
Sowohl die Unterschiede in Phosphorylierungsstellen, Konformation, und
Bindungskonstanten, als auch die Beeinflussung von oder durch andere Proteine
und Faktoren, die veröffentlicht wurden, lassen auf eine durchaus unterschiedliche
Funktion der drei GGA-Proteine schließen.
1 Einleitung
16
Eine Übereinstimmung oder Unterschiedlichkeit der Lokalisation und Funktion von
GGA1, GGA2 und GGA3 hinsichtlich der Interaktion mit BACE soll in dieser Arbeit
im lebenden Zellmodell untersucht werden.
1.4 Transportwege und Interaktionen
Sowohl APP, als auch BACE werden in ihrem Transportweg durch die Zelle
vermutlich von vielen verschiedenen Faktoren direkt oder indirekt beeinflusst. Die
folgende Tabelle stellt eine Auswahl dieser Faktoren dar.
Tabelle 1: Moleküle, die den Transportweg von APP und BACE möglicherweise beeinflussen
Coat Complexes
Clathrin Heavy Chains, Clathrin Light
Chains, VPS (Vacuolar Protein
Sorting)35, VPS26A, VPS26B, VPS29,
Sorting Nexin 1 und 2, ARF
(Adenosindiphosphat-Ribosylation
Factor)
Coat Adaptors
sorLA (Lipoprotein Rezeptor), Sortilin,
Fe65, GGA1, GGA2, GGA3
Faktoren für Andocken und Fusion
Syntaxin5, Rabaptin5, VPS45
Protein oder Lipid
PKA (Protein Kinase A), PKC (Protein
Kinasen/Phosphatasen
Kinase C), VPS30
Andere Faktoren
Presenilin1, Presenilin2, Nicastrin,
Lipideinschnürungen, Cholesterol
Alle diese Faktoren spielen eine Rolle im Transport von BACE und APP von der
Zelloberfläche zu den Endosomen und von dort in das TGN. Theoretisch könnte
eine Manipulation von jedem dieser Moleküle zu einer Beeinflussung des
Transportes und der Aβ-Produktion führen (Small und Gandy 2006). Für viele
Moleküle dieser Liste konnte dies bereits nachgewiesen werden, allerdings
wurden nur wenige (VPS35, VPS26, sorLA) mit tatsächlicher struktureller
Veränderung in Gehirnen von Alzheimer Patienten gefunden.
Die GGA-Proteine sind besonders interessante Transportproteine in diesem
Zusammenhang, da sie selbst mit vielen anderen Faktoren dieser Liste
1 Einleitung
17
interagieren. Sie haben eine Clathrin-Bindungsstelle, können phosphoryliert
werden und haben eine Bindungsstelle für ARF.
Es wurde gezeigt, dass GGA1- Proteine zusätzlich zu ihrer Funktion im Transport
von Proteinen vom TGN zu den Endosomen hin, auch eine Rolle im retrograden
Transportweg von BACE von den Endosomen zum TGN spielen. Es wird
vermutet, dass der von dem Phosphorylisierungszustand abhängige retrograde
Transportweg von BACE durch die GGA Proteine beeinflusst wird. Vom ER wird
BACE über den Golgi-Apparat zur Zelloberfläche transportiert. Der gleiche
Transportweg kann für andere Proteine, wie zum Beispiel APP beobachtet
werden.
Von
der
Zelloberfläche
werden
diese
Proteine
in
Endosome
reinternalisiert (Abb.7).
In den Endosomen findet zusätzlich zur Spaltung an der Zelloberfläche eine
vermehrte proteolytische Spaltung der verschiedenen Substrate von BACE, wie
zum Beispiel APP statt. Eine Phosphorylierung des C-terminalen Serin 498 Restes
verstärkt die Interaktion von BACE mit GGA1 und so den retrograden Transport
zum TGN, während ein Mangel an Phosphorylierung zu einem Recycling von
BACE zur Zelloberfläche führt. Durch einen zweiten Transport zur Zellmembran
und der darauf folgenden erneuten Reinternalisierung kommt es zu weiteren
Prozessierungen von APP und somit zur vermehrten Produktion von Aβ (Wahle et
al. 2005).
1 Einleitung
18
B
A
C
Abb. 7: Transport des Amyloid Precursor Proteins (APP) und β-site of APP cleaving-enzyme
(BACE) durch Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factorbinding protein 1 (GGA1) (Wahle et al. 2006)
BACE und APP teilen einen ähnlichen sekretorischen Transportweg vom Golgi-Apparat zur Zelloberfläche, wo
es zur Prozessierung von APP durch BACE und zur Entstehung von sekretiertem APP (APPs) und Amyloidβ
(Aβ) kommt (1). Beide Proteine können von der Zelloberfläche (cell surface) in endosomale Kompartimente
(early endosomes und late endosomes) endozytiert werden, wo auch eine Prozessierung von APP stattfindet
(2). GGA1 Proteine sind in den retrograden Transport von den endosomalen Kompartimenten zum GolgiApparat und zu dem Trans-Golgi-Network involviert (3). GGA1 könnte den Anteil von BACE in den
endosomalen Kompartimenten reduzieren, was eine geringere Entstehung von Aβ zur Folge hätte.
Zusätzliche GGA1-abhängige Mechanismen und Interaktionen (Symbol:?) könnten den Transport von BACE
vom Golgi zu den endosomalen Kompartimenten erhöhen und somit die Entstehung von Aβ fördern.
Da GGA1 einen maßgeblichen Einfluss auf die Möglichkeit des Transportes
zurück zum TGN hat und somit eine Förderung der Bindung zwischen diesen
Proteinen einen positiven Einfluss auf das Entstehen von Aβ-Plaques haben
könnte, muss sowohl dieses Protein, als auch GGA2 und GGA3 und ihre Rolle im
Transportweg von BACE und APP durch die Zelle und somit der Entstehung der
Alzheimer Erkrankung weiterhin untersucht werden (Wahle et al. 2005).
Kürzlich wurde herausgefunden, dass GGA3 während der Apoptose von Zellen
von Caspase-3 abgebaut wird. Daraus folgte eine Stabilisierung von BACE und so
1 Einleitung
19
eine vermehrte Prozessierung von APP. Auch eine Unterdrückung der GGA3Produktion durch inhibitorische RNA (RNAi) führte zu dem gleichen Phänomen
(Tesco et al. 2007). Da die GGAs auch eine Rolle in dem Transport von BACE zu
Lysosomen der Zelle zu spielen scheinen (Koh et al. 2005), lässt sich postulieren,
dass eine Inaktivierung der GGAs durch Caspase-3 zu einem verminderten
Transport von BACE zu den Lysosomen führt und somit die Prozessierung von
APP und damit auch die Konzentration von Aβ außerhalb der Zellen ansteigt. In
Gehirnproben von Alzheimerpatienten konnte im Temporallappen festgestellt
werden, dass dort neben einer erhöhten Konzentration von Aβ eine gleichzeitige
Erhöhung von BACE vorlag. Diese vermehrte BACE Konzentration korrelierte
umgekehrt proportional zu einem erniedrigten GGA3-Level (Tesco et al. 2007).
Dies zeigt noch einmal die signifikante Rolle, die die Proteine der GGA-Familie in
der Entstehung der Alzheimer Erkrankung spielen könnten.
1.5 Zielsetzung
Die bisherige Forschung beschränkte sich meistens auf die Untersuchung von
einzelnen GGA Proteinen und stützte sich vor allem auf die Proteinbiochemie und
Fluoreszenzmikroskopie
mit
fixierten
Zellen.
Diese
geben
jedoch
den
physiologischen Zustand einer Zelle nur unzureichend wieder, da es zu multiplen
Färbe- und Fixierungsartefakten kommt Und obwohl ein lebendes Zellmodell auch
nur ein Modell ist, hat es dennoch den Vorteil, die zellulären Vorgänge
physiologischer abbilden zu können als eine fixierte Zelle.
Die meisten Ergebnisse wurden mit GGA1 als Beispiel für Proteine der GGAFamilie veröffentlicht. GGA2 und GGA3 wurden in den meisten Untersuchungen
vernachlässigt und sollen hier parallel zu GGA1 untersucht werden.
Diese Arbeit soll zunächst einen Überblick über die Lokalisation von BACE und
Proteinen der GGA-Familie in der lebenden Zelle geben. Weiterhin soll untersucht
werden, ob sich ein Unterschied zwischen GGA1, GGA2 und GGA3 hinsichtlich
der Verteilung im TGN darstellen lässt. Außerdem wird gezeigt, ob es zu einer
Veränderung der Proteinverteilung bei gleichzeitiger Expression von BACE mit
den GGAs kommt. Auch die Kolokalisation der Proteine wird mit der Methode der
Konfokalen Laser Mikroskopie nachgewiesen.
1 Einleitung
20
In den darauf folgenden Experimenten soll die tatsächliche Interaktion im
lebenden Zellmodell mit Hilfe der FRET/FLIM Methode für GGA1, GGA2 und
GGA3 zusammen mit BACE nachgewiesen werden.
Als letzter Schritt soll schließlich die VHS-Domäne in vivo und ohne extreme
Manipulationen des physiologischen Zellmilieus als Bindungsdomäne der GGA
Proteine mit BACE bestätigt werden und auch das DXXLL-Motiv von BACE soll
als potentielle und physiologische relevante Interaktionsstelle zwischen den
Proteinen bestätigt werden.
Diese Arbeit soll dadurch zur weiteren Aufklärung der Transport- und Signalwege
im Rahmen der Grundlagenforschung der Alzheimer Erkrankung dienen und dazu
beitragen, einen molekular gesicherten Angriffspunkt für eine erfolgreiche
medikamentöse Therapie der Betroffenen zu finden.
2 Material und Methoden
21
2 Material und Methoden
2.1 Material
Bakterienstämme
Tabelle 2: Bakterienstämme
Produktbezeichnung
Hersteller
Escherichia coli DH5α™
Invitrogen GmbH (Karlsruhe,DE)
Im Rahmen dieser Arbeit wurde der Bakterienstamm Escherichia coli
DH5α™ mit einer Effizienz von 1 x 106 bis 1 x 109 Transformationen/µg und
folgendem Genotyp: F-
80dlacZ∆M15 ∆(lacZYA-argF) U169 recA1 endA1
hsdR17(rk-, mk+) phoA supE44 λ- thi-1 gyrA96 relA1 (Grant et al. 1990) verwendet.
Die Aufbewahrung erfolgt bei -80°C.
Zellinien
Tabelle 3: Zellinien
Produktbezeichnung
Beschreibung
N2A-Zellen
Die N2A-Zellinie (DSMZ ACC 148)
besteht aus Neuroblastomzellen der
Maus, diese Zelllinie entstand aus
einem spontanen Tumor einer Stamm
A Albino Maus (Olmsted et al. 1970).
U373-Zellen
Die
U373-Zellen
stammen
aus
(ATCC
einem
Glioblastom-Astrozytom
jährigen
Kaukasiers
Macintyre 1968).
HTB
17)
humanen
eines
61-
(Ponten
und
2 Material und Methoden
22
DNA-Vektoren
Tabelle 4: DNA- Vektoren
Originalvektor
Beschreibung/Quelle
Verwendet im Vektor
BACE(LL499/500AA)-V5
(von Arnim et al. 2004)
BACE(LL499/500AA)-EGFP
BACE-EGFP
(von Arnim et al. 2005)
BACE-mRFP
APP-mRFP
(von Arnim et al. 2008)
BACE-mRFP
GGA1-myc-his
Robinson, University of GGA1-EGFP
Cambridge, UK
GGA1-mRFP
GGA2-myc-his
Robinson, University of GGA2-EGFP
Cambridge, UK
GGA2-mRFP
GGA2-∆VHS-EGFP
∆: deletierte Domäne
GGA3-myc-his
Robinson, University of GGA3-EGFP
Cambridge, UK
GGA3-mRFP
GGA3-∆VHS-EGFP
GGA1-∆VHS-myc
(von Arnim et al. 2006)
GGA1-∆VHS-EGFP
Als Beispiel für die DNA Plasmide soll BACE-EGFP dienen (Abb.8). Es besteht
aus dem Original Plasmid Rückgrat der Universität von Californien (pUC ori),
einem CMV-Promotor, einer Kanamycin und Neomycin Resistenz zur Selektion,
der EGFP-DNA, der BACE-DNA und besteht insgesamt aus 6405 Basenpaaren
(bp).
2 Material und Methoden
23
Abb. 8: β- Amyloid- Cleaving Enzym (BACE)- EGFP Plasmid DNA
CMV: Cytomegalievirus zur Expression in eukaryoten Zellen
Start 764: Die BACE-DNA beginnt ab dem 764 Basenpaar
KanR/NeoR: Kanamycin Resistenz und Neomycin Resistenz
pUC ori: plasmid University of California origin
bp: Basenpaare
Living Color Tags
Tabelle 5: Living Color Tags
Originalvektor
Bezugsquelle
pEGFP-C1
Clontech Laboratories, Mountain View
CA, USA (GenBank: U55763)
pEGFP- N3
Clontech Laboratories, Mountain View
CA, USA (GenBank: U55763)
mRFP-N1
Tsien
Lab,
La
Jolla
CA,
USA
(GenBank: AF506027)
In dieser Arbeit wurde ausschließlich mit den Fluorophoren mRFP und EGFP
gearbeitet. Das monomere Red Fluorescence Protein (mRFP) kann bei einer
Wellenlänge um die 543 nm angeregt werden und hat sein Emissionsmaximum
bei circa 612 nm. Das Enhanced Green Fluorescence Protein (EGFP) findet seine
Exzitation bei 488 nm und hat sein Emissionsmaximum bei 506 nm (Abb.9).
24
Exzitationund Emission in Prozent
2 Material und Methoden
Wellenlänge in nm
Abb. 9: Exzitation und Emission der Fluorophore Enhanced Green Fluorescent Protein
(EGFP) und modifiziertes Red Fluorescent Protein (mRFP) (Invitrogen Fluorescence Spectra
Viewer, www.invitrogen.com)
EGFP (grün) hat eine Exzitationskurve (gestrichelte Linie), die mit einem 488 nm Laser angeregt werden kann
und ein Emissionsmaximum (durchgängige Linie) bei 506 nm.
mRFP (rot) hat eine Exzitationskurve (gestrichelte Linie), die mit einem 543 nm Laser angeregt werden kann
und ein Emissionsmaximum (durchgängige Linie) bei circa 612 nm.
Oligonukleotide
Für die Klonierungen, die nicht mit Restriktionsendonukleasen durchgeführt
werden konnten, da keine entsprechenden Schnittstellen vorhanden waren,
wurden folgende Oligonukleotide für die Polymerase Ketten Reaktion (PCR)
verwendet.
Tabelle 6: Oligonukleotide (B. von Einem)
Bezeichnung
Forward Primer
Reverse Primer
Amplifizier-
TATGCTAGCCACCATGGC
AATCTCGAGGGCTGCGCCCA
Primer für
GGCGA
AGA
GGA2-FL in
Einbringen
mRFP-N1
Schnittstelle (GCTAGC)
einer
NheI- Einbringen
einer
XhoI-
Schnittstelle (CTCGAG)
PCR-Primer für TGCTAGCATGGACCCTAA
TATCTCGAGTGGCTGCGCCC
GGA2-∆VHS
(68,1°C)
ACTACC (62,7°C)
PCR-Primer für TGCTAGCATGGACCCACC
TATCTCGAGTTAGGTTCCCCC
GGA3-∆VHS
A (62.0°C)
AATT (65.9°C)
2 Material und Methoden
25
Enzyme und Enzympuffer
Tabelle 7: Enzyme und Enzympuffer
Produktbezeichnung
Hersteller
BamHI, 20.000 U/ml
New England BioLabs Frankfurt, DE
NheI , 10.000 U/ml
New England BioLabs Frankfurt, DE
SacII, 20.000 U/ml
New England BioLabs Frankfurt, DE
NotI, 10.000 U/ml
New England BioLabs Frankfurt, DE
XhoI, 20.000 U/ml
New England BioLabs Frankfurt, DE
NdeI, 20.000 U/ml
New England BioLabs Frankfurt, DE
KpnI, 10.000 U/ml
New England BioLabs Frankfurt, DE
EcoRV, 20.000 U/ml
New England BioLabs Frankfurt, DE
HindIII, 20.000 U/ml
New England BioLabs Frankfurt, DE
T4 Quick Ligase
New England BioLabs Frankfurt, DE
Vent DNA Polymerase
New England BioLabs Frankfurt, DE
T4 Quick Ligase Puffer
New England BioLabs Frankfurt, DE
Puffer 2,3,4
New England BioLabs Frankfurt, DE
ThermoPol Reaction Puffer (10x)
New England BioLabs Frankfurt, DE
6x Loading Dye Solution
Fermentas St. Leon-Rot, DE
1x 0,5% Trypsin-EDTA
Invitrogen GmbH Karlsruhe, DE
Fragmentlängenstandards
Tabelle 8: Fragmentlängenstandards
Produktbezeichnung
Hersteller
MassRuler™Express DNA Ladder Mix Fermentas St. Leon-Rot, DE
Forward
2 Material und Methoden
26
Bakterienkulturmedien/ Zellkulturmedien
Tabelle 9: Bakterienkulturmedien/ Zellkulturmedien
Produktbezeichnung
Hersteller
Lysogeny Broth (LB) Medium
Carl Roth GmbH&Co.KG Karlsruhe, DE
(Luria/Miller)
Lysogeny Broth (LB) Agar (Luria/Miller)
Carl Roth GmbH&Co.KG Karlsruhe, DE
SOC-Medium
Invitrogen GmbH Karlsruhe, DE
Dulbecco’s Modified Eagle Medium
Invitrogen GmbH Karlsruhe, DE
(DMEM)
RPMI 1640 with L-Glutamine, without
Invitrogen GmbH Karlsruhe, DE
Phenol Red
Dulbecco’s Phosphate Buffered Saline
PAA Laboratories GmbH, Pasching, A
with Ca/Mg Solution (PBS+)
Newborn Calf Serum (NCS)
Biochrom AG Berlin, DE
Antibiotika
Tabelle 10: Antibiotika
Produktbezeichnung
Hersteller
Kanamycin Sulphate Solution
Invitrogen GmbH Karlsruhe, DE
Ampicillin Sodium Salt Solution
Invitrogen GmbH Karlsruhe, DE
Penicillin/Streptomycin
Biochrom AG Berlin, DE
Verwendete Kits
Tabelle 11: Verwendete Kits
Produktbezeichnung
Hersteller
PureLink™ Quick Gel Extraction Kit
Invitrogen GmbH Karlsruhe, DE
PureLink™ HiPure Plasmid DNA
Invitrogen GmbH Karlsruhe, DE
Purification Kit
PureLink™ PCR Purification Kit
Invitrogen GmbH Karlsruhe, DE
2 Material und Methoden
27
Computer Programme
Zusätzlich zu Standard Computer Programmen wurden folgende Programme zur
Auswertung und Bearbeitung der akquirierten Daten verwendet.
Tabelle 12: Computer Programme
Produktbezeichnung
Hersteller
ImageJ 1.37v
Rasband, National Institute of Health,
USA
LSM-Image Browser Version 4.0.0.157
Carl Zeiss MicroImaging GmbH Jena,
DE
pDraw 32.1.0
ACACLONE Software
Sigma Stat 3.1
Systat Software Inc. Erkrath, DE
Sigma Plot 9.0
Systat Software Inc. Erkrath, DE
SPCImage 2.8
Becker&Hickl GmbH Berlin, DE
2.2 Methoden
2.2.1 DNA-Methoden
Handhabung rekombinanter Bakterien
Für die Anzucht der Bakterien wurde LB-Medium verwendet. In Flüssigkultur
wurde dem Medium das entsprechende Antibiotikum zugesetzt, um nur die
Bakterien zu kultivieren, die das erwünschte Plasmid mit der entsprechenden
Resistenz tragen. Um eine Reinkultur zu gewährleisten, wurden bei Bedarf die
Kolonien auf LB-Agar-Platten zur Vereinzelung ausgestrichen. Für die Herstellung
der LB-Agar-Platten wurden dem Medium 15 g/l Agar zugesetzt. Die Medien
wurden
generell
autoklaviert,
um
eine
Verunreinigung
mit
anderen
Mikroorganismen zu vermeiden.
Transformation chemisch kompetenter Zellen
Zunächst werden 2 µl des Ligationsansatzes oder 5 ng des zu vermehrenden
Plasmides zu den gefrorenen E.coli DH5α Bakterien gegeben. Diese werden
daraufhin 10 min auf Eis inkubiert, 50 sek in das
42 °C warme Wasserbad
2 Material und Methoden
28
gebracht und anschließend 2 min auf Eis gelegt. Es wird 800 µl SOC-Medium
hinzugegeben und die Bakterien werden für 60 min bei 37 °C geschüttelt.
100 bis 200 µl werden nun auf LB-Agar-Platten ausplattiert, die mit dem
Antibiotikum beschichtet sind, gegen das eine Resistenz in dem Plasmid vorliegt.
Über Nacht werden die Platten bei 37 °C inkubiert.
Glycerinkulturen
Glycerinkulturen werden zu einer längerfristigen Lagerung von Bakterien angelegt.
Dazu werden 800 µl einer Bakterien-Suspension mit 200 µl einer über 98 %
Glycerin-Lösung (Carl Roth GmbH&Co.KG Karlsruhe,DE) in einem EppendorfReaktionsgefäß gemischt und unmittelbar bei -70 °C gefroren und gelagert. Eine
kleine Menge dieser Suspension kann im Bedarfsfall wieder auf einer LB-AgarPlatte mit dem entsprechenden Antibiotikum ausgestrichen, im Brutschrank
inkubiert und zur weiteren Verwendung angezüchtet werden.
Plasmidisolierung aus Bakterien: “Easyprep“
Eine sehr einfache und schnelle Methode um Plasmid-DNA zu gewinnen ist die
von Berghammer und Auer 1993 beschriebene Methode der “Easyprep“. Die
Easyprep ist nur für endA--Stämme geeignet, da die Endonuklease A nicht durch
Hitze inaktivierbar ist und so die DNA abbauen würde.
Bei der Easyprep wird 1 ml LB-Medium mit entsprechendem Antibiotikum in eine
Eppendorfgefäß gefüllt und mit der gewünschten Bakterien-Kolonie angeimpft.
Dies kann wahlweise mit einer Impföse oder einem autoklavierten Zahnstocher
erfolgen. Der Deckel wird zur besseren Sauerstoffzufuhr eingestochen und die
Kultur über Nacht bei 37 °C und unter ständiger Bewegung inkubiert. Nach
30-60 sek in der Zentrifuge (14.000x g, RT) wird der Überstand abgesaugt und
das Pellet in 50 µl Lysispuffer (10 mM Tris pH 8,0, 1 mM EDTA, 15%Sukrose,
0,4 mg/ml RNAse A, 2 mg/ml Lysozym, 0,1 mg/ml BSA) gelöst. Nach 5 Minuten im
Schüttler bei Raumtemperatur wird das Eppendorfgefäß in einen Thermoblock
(Thermomixer comfort, Eppendorf) bei 100 °C für 30 sek erhitzt um anschließend
60 sek auf Eis inkubiert zu werden. Nach abschließenden 20 min Zentrifugation
bei Raumtemperatur und 14.000x g wird bis zu 5 µl des Überstandes für eine
2 Material und Methoden
Testspaltung
und
29
eine
spätere
Agarosegel-Elektrophorese
eingesetzt
(Berghammer und Auer 1993).
Plasmidisolierung aus Bakterien: Isolierung mit Kits
Zur Isolierung hochreiner DNA, die für Klonierungen, Sequenzierungen und
Transfektionen der N2A und U373 Zellinien benötigt wird, werden die “PureLink™
HiPure Plasmid DNA Purification Kits for Mini, Midi and Maxi preparation of
Plasmid DNA“ von der Firma Invitrogen (Carlsbad, USA) verwendet. Die Prozedur
erfolgt nach Angaben des Herstellers im User Manual Version C vom 11. Oktober
2005.
Agarosegelelektrophorese
Die Agarosegelelektrophorese ist eine Methode, die DNA-Fragmente ihrer Größe
nach auftrennt. Diese können mit Hilfe eines mit DNA interkalierenden Farbstoffes
wie Ethidiumbromid unter UV-Licht sichtbar gemacht werden. In einem
Gleichspannungsfeld wandert die DNA in Richtung der Anode, wobei kleinere
Fragmente diese schneller erreichen als größere. Zur Herstellung der Gele wird 1
% Agarose (Invitrogen) in 1x TAE-Puffer (40 mM Tris, 20mM Essigsäure, 1 mM
EDTA pH 8,0) eingewogen, aufgekocht und in einen Gelschlitten gegossen. Je
nach Größe des Gels wird zwischen 0,3 µl und 3 µl Ethidiumbromid dazugegeben
und ein Gelkamm eingesteckt. Nach der Härtung wird der Kamm entfernt und die
Proben mit einem Probenpuffer in die Geltaschen pipettiert. Zur Kontrolle wird ein
Fragmentlängenstandard aufgetragen und die Fragmente werden mit einer
Spannung von 5-10 V/cm² für circa 30 min aufgetrennt.
Fotodokumentation
Nach der Elektrophorese wird das Gel auf einen UV-Transilluminator (BioRad
GelDoc
1000)
aufgelegt
und
die
DNA-Fragmente
werden
durch
das
fluoreszierende Ethidiumbromid sichtbar gemacht. Zur Dokumentation der
Laufweite und damit der Größe der einzelnen Banden wird eine Digitalkamera und
ein Thermodrucker (Mitsubishi Video Copy Processor P66DE) benutzt.
2 Material und Methoden
30
DNA-Extraktion aus Agarosegelen
Wird im Laufe des Klonierungsprozesses nach einer Restriktionsspaltung nur ein
bestimmtes Fragment eines Plasmides zum weiteren Arbeiten benötigt, so kann
die verdaute DNA über eine Agarose-Gelelektrophorese aufgetrennt werden.
Daraufhin
werden
auf
einem
UV-Transilluminator
die
Größen
der
sich
darstellenden Fragmente bestimmt und die gewünschte Bande mit einem Skalpell
aus dem Gel getrennt. Für die Extraktion der DNA aus dem gewonnenen Stück
Agarosegel wird das “PureLink™ Quick Gel Extraction Kit“ (Invitrogen, Carlsbad,
USA) verwendet. Die Prozedur erfolgt nach den Angaben des Herstellers im User
Manual Version B vom 15. März 2005.
Konzentrationsbestimmung von Nukleinsäuren
Da die DNA meist nur in kleinen Mengen und Volumina zur Verfügung steht, wird
die Konzentration in einer Verdünnung bestimmt. 2 µl DNA werden mit 58 µl Tris
pH 8,0 (USb Corporation, Cleveland, USA) gemischt und die Absorption bei
260 nm im Photometer bestimmt. Eine Absorption von 1,0 entspricht dabei
50 µg/ml dsDNA. Die Messung der Absorption bei 280 nm und das Errechnen der
Quotienten der beiden Messungen gibt Auskunft über die Reinheit der Proben.
Wird dabei ein Verhältnis von 1,8 bis 2,0 erreicht, nimmt man eine reine
Präparation an.
Eine weitere angewandte Methode der Konzentrationsbestimmung ist das
Abschätzen
anhand
Ethidiumbromids.
der
Fluoreszenz
Dazu
Fragmentlängenstandard
wird
mit
einer
die
des
in
der
DNA
DNA-Probe
bekannten
interkalierten
gegen
Konzentration
einen
auf
einem
Agarosegel aufgetragen und im elektrischen Feld aufgetrennt. Unter UV-Licht
können die durch das Ethidiumbromid fluoreszierenden Banden in Bezug auf das
Mengenverhältnis
zwischen
dem
eingesetzten
Standard
mit
bekannter
Konzentration und der zu bestimmenden, unbekannten Probenkonzentration
bewertet werden.
Restriktionsspaltung von DNA
Je nach Menge der zu spaltenden DNA wird das Gesamtvolumen des
Restriktionsansatzes bestimmt. Für Testspaltungen wird 0,5 µg DNA, ca. 0,5 µl
2 Material und Methoden
31
Restriktionsenzym (die Menge ist abhängig von der spezifischen Konzentration
und Aktivität der Enzyme) und 2 µl 10-fach Puffer in ein Reaktionsgefäß gegeben
und mit destilliertem, sterilem Wasser auf das Gesamtvolumen von 20 µl
aufgefüllt. Bei größeren DNA Mengen, wie sie für Ligationen benötigt werden, wird
ein Gesamtvolumen von 50-100 µl eingesetzt, wobei der Anteil der DNA bei
5-10 µg, das Enzym bei 2 µl liegt und der Pufferkonzentrateinsatz entsprechend
errechnet wird.
Optional kann bei Restriktionsspaltungen Rinderserumalbumin (BSA) in einer
Endkonzentration von 0,1 µg/µl zur Stabilisierung der Restriktionsenzyme dem
Spaltungsansatz hinzugegeben werden. Die Ansätze werden bei der spezifischen
Reaktionstemperatur der Restriktionsenzyme zwischen 3 und 18 Stunden, je nach
anschließender Verwendung, inkubiert.
DNA-Ligationen
Durch Ligationen wird im Rahmen einer Klonierung ein DNA-Fragment (Insert) in
einen
Zielvektor
integriert.
Dazu
wird
der
Vektor
mit
der
gleichen
Restriktionsendonuklease geöffnet mit der das Insert geschnitten wurde. Bei einer
gerichteten
Ligation
werden
zwei
Enzyme
mit
unterschiedlicher
Erkennungssequenz benutzt. So kann das Insert nur in einer bestimmten
Orientierung in den Vektor eingefügt werden. Die Ligation erfolgt mit der T4
QuickLigase
und
dem
dazugehörigen
Puffer.
Das
Gesamtvolumen
des
Ligationsansatzes beträgt 20 µl. Das molekulare Verhältnis von Vektor zu Insert ist
1:3. Es wird 1 µl T4 QuickLigase und 10 µl des Puffers eingesetzt und 50 ng
Vektor mit 150 ng Insert in 10 µl destilliertes, steriles Wasser eingebracht. Der
Ansatz wird für 15 sek bei 14.000x g zentrifugiert, dann 5 min bei 25 °C inkubiert
und 15 min auf Eis gelagert, bevor er zur Transformation der E.coli benutzt
werden kann.
Polymerase- Kettenreaktion
Um DNA selektiv zu amplifizieren wird die Methode der PolymeraseKettenreaktion (PCR) benutzt. Hierfür werden Oligonukleotid-Primer synthetisiert,
die in gegenläufiger Richtung an den komplementären DNA-Strang der Ziel-DNA
binden. Nach der Denaturierung der DNA durch Hitze bei 92 °C bis 94 °C werden
2 Material und Methoden
32
die angelegten Primer von einer hitzestabilen DNA-Polymerase bei circa 72 °C
verlängert. Dieser Vorgang wird 30-40mal wiederholt. Es wurde folgender Ansatz
benutzt: 0,2 μg DNA (Template), jeweils 10 pmol des Forward und des Reverse
Primers, 5 μl ThermoPol Reaktions Puffer, 0,2 mM Deoxynukleotid Solution Mix
(New England Biolabs GmbH, Frankfurt, DE) und 0,4 U der Vent DNA
Polymerase. Dieser Ansatz wurde auf 50 μl mit sterilem Wasser aufgefüllt und die
PCR nach dem beschriebenen Protokoll mit einer Annealing Temperatur von 60
°C in der PCR-Maschine (Techne Techgene, Cambridge, England) durchgeführt.
Danach wird das PCR- Produkt mit dem PureLink PCR Purification Kit (Invitrogen)
nach den Angaben des Herstellers im User Manual Version A von 2004,
gesäubert und für die weiteren Klonierungsschritte verwendet.
Sequenzierung
Alle Sequenzierungen wurden bei der Firma GATC in Konstanz, DE in Auftrag
gegeben. So konnte die korrekte Aminosäurenabfolge der Plasmide und eine
erfolgreiche Klonierung sichergestellt werden.
2.2.2 Zellkultur-Methoden
Sämtliche Materialen wurden als sterile Einmalplastikware verwendet oder im
Falle von Glasmaterialien vor dem Gebrauch autoklaviert. Alle verwendeten
Medien und ihre Zusätze wurden als sterile Flüssigprodukte vom jeweiligen
Hersteller bezogen. Die Arbeiten erfolgten in einer Reinraumwerkbank (Hera Safe,
Heraeus) unter Berücksichtigung aller nötigen Maßnahmen um ein steriles
Arbeiten zu gewährleisten.
N2A-Kultur und U373-Kultur
Die beiden verwendeten Zellmodelle unterscheiden sich bei der Behandlung der
jeweiligen Kultur nur durch das zu verwendende Nährmedium, wobei die N2AZellen in DMEM und die U373-Zellen in RPMI jeweils mit 10% NCS und 5 ml
Penicillin/Streptomycin auf 500 ml Medium kultiviert werden. Im Weiteren soll ihre
Behandlung und Verwendung gemeinsam beschrieben werden.
2 Material und Methoden
33
Einfrieren und Auftauen von Zellen
Für die Lagerung von Zellen in flüssigem Stickstoff werden diese zunächst
resuspendiert und bei 900x g 5 min bei RT abzentrifugiert. Das hierbei
entstehende Pellet wird auf Eis in dem entsprechenden Medium versetzt mit 10%
Dimethylsulfoxid resuspendiert und in vorgekühlte Kryoröhrchen zu 1 ml Portionen
(circa 1x 106 Zellen/ml) abgefüllt. Mit dem NALGENETM Cryo Freezing Container
(Thermo Fisher Scientific, Rochester, USA) werden die Röhrchen bei -80°C pro
Minute um 1°C herabgekühlt und anschließend in den Flüssigstickstofftank
überführt.
Zum Auftauen der Zellen werden die Kryoröhrchen aus dem Stickstofftank in ein
Wasserbad von 37°C gegeben und in 10 ml des entsprechenden vorgewärmten
Kulturmediums überführt. Nach vorsichtigem Abzentrifugieren bei 900x g 5 min bei
RT wird das Zellpellet im vorgewärmten Zellkulturmedium resuspendiert und in
einer Kulturflasche ausgesät.
Ablösen adhärenter Zellen
Um die adhärenten Zellen in neue Kulturgefäße zu überführen oder um die
Zelldichte bestimmen zu können, wird zunächst das Medium abgesaugt und die
Zellen einmal mit PBS gewaschen. Anschließend wird 20 µl/cm2 Trypsin
hinzugegeben und bei 37°C 5 min inkubiert. Nachdem sich die Zellen vom Boden
gelöst haben werden sie nun in ihrem entsprechenden Medium resuspendiert.
Passagieren und Splitten von Zellen
Die abgelösten Zellen in ihrem Medium werden in Portionen von jeweils 10 ml
5 Minuten bei 25°C und 900x g zentrifugiert. Der Überstand wird abgesaugt und
das Pellet in 10 ml frischem Medium resuspendiert. Je nach gewünschter
Zellmenge werden zwischen 50 und 500 µl dieser Suspension in eine neue, mit
20ml vorgewärmten Medium befüllte Kulturflasche pipettiert. Je nach Bedarf der
Zellinie
wird
dem
Penicillin/Streptomycin
Medium
zur
Mikroorganismen zugegeben.
NCS
zum
Vorbeugung
effizienten
einer
Wachstum
Kontaminierung
und
durch
2 Material und Methoden
34
Transfektion von Plasmid-DNA
Zur Transfektion der kultivierten Zellinien mit Plasmid-DNA wurden zunächst die
Zellen in einer Konzentration von 3,6-3,8 x 104 Zellen pro cm² in 35 mm Schälchen
(Glass Bottom uncoated, MatTek Corp, Ashland, MA, USA) ausgesät. Die
Transfektion kann je nach Dichte der Zellen direkt oder am darauffolgenden Tag
durchgeführt werden. 2 µg der DNA wurde mit 100 µl DMEM oder RPMI in einem
Reaktionsgefäß inkubiert. In einem getrennten Gefäß wurden 100 µl DMEM mit 3
µl der Transfektionsreagenz SatisFection™(Stratagene, La Jolla, USA) angesetzt.
Nach 15 Minuten werden die beiden Lösungen zusammen pipettiert, vorsichtig
umgerührt und unter leichtem Schwenken in die Zellschälchen gegeben. Bei den
verwendeten Plasmiden betrug die benötigte Inkubationszeit für die N2A-Zellen 12
Stunden und für die U373-Zellen 24 Stunden. Nach diesen Zeitpunkten ließ sich
eine Transfektionseffizienz von 30-40% und ein minimaler Anteil an bereits
apoptotischen Zellen feststellen.
2.2.3 Konfokale Laserscanning Mikroskopie
Der besondere Vorteil der Konfokalen Laserscanning Mikroskopie besteht darin,
dass sie das von einer einzigen Ebene des Präparats reflektierte oder emittierte
Licht erfasst.
Eine zur Fokusebene konjugiert angeordnete Lochblende (Pinhole) sorgt dafür,
dass Licht, welches nicht aus der Fokusebene stammt, vom Detektor nicht erfasst
wird. Ein Laserstrahl rastert das Präparat pixel- und zeilenweise ab. Die
Pixeldaten werden dann zu einem Bild zusammengesetzt, das einen optischen
Schnitt durch das Präparat darstellt und sich durch hohen Kontrast und hohe
Auflösung auszeichnet. Wenn die Mehrfachfluoreszenzanalyse optimiert werden
soll, bietet das Laser Scanning Mikroskop (LSM 510 META) die Möglichkeit, den
Metatracking (META)-Detektor mit anderen Einzeldetektoren zu kombinieren.
Damit ist man in der Lage, den Spektralbereich des META-Detektors
entsprechend seinen Anforderungen zu konfigurieren und gleichzeitig die
Signalausbeute über den Einzeldetektor zu maximieren. Es gibt die Möglichkeit,
die Größe und Lage des Pinholes für jeden einzelnen Detektor individuell
einzustellen. (LSM 510Mk4 and LSM 510 METAMk4 Laser Scanning Mikroskope,
Prospekt
45-0066
d/0.06,
Carl
Zeiss
MicroImaging
GmbH
Jena,
DE).
2 Material und Methoden
Signalübersprechen
(Crosstalk)
Mehrfachfluoreszenzmikroskopie.
35
ist
das
häufigste
Emissionsseitiges
Problem
Crosstalk
in
der
zwischen
Farbstoffen kann durch selektive Anregung mittels der Metatracking-Funktion
leicht vermieden werden. So ist es auch möglich, Fluorophore mit überlappenden
Anregungsspektren zu verwenden (Abb.10).
Abb. 10: Prinzip des Metatrackings durch den META-Detektor (Carl Zeiss MicroImaging
GmbH)
Intensität des Anregungs- und Emissionssignales als Funktion der Wellenlänge für zwei Fluorochrome mit
stark überlappenden Emissionsspektren. Durch selektive Exzitation (Ex1, Ex2) und Wellenlängen angepasste
Detektion (Track1, Track2) können die Emissionen (Em1, Em2) der Fluorochrome (Fluorochrom1, blau und
Fluorochrom2, grün) voneinander abgegrenzt werden.
Die verwendeten Laser waren ein Helium-Neon-Laser und ein Argon-Laser. Die
Anregung erfolgte für den grünen Fluoreszenzfarbstoff (EGFP) bei 488 nm bei
einer Laserstärke des Helium-Neon-Lasers von 10%, für den roten FluoreszenzFarbstoff (mRFP) bei 543 nm bei einer Laserstärke des Argon-Lasers von 100%.
Es wurde ein Bandpassfilter (BP) von 500-550 nm und ein Langpassfilter (LP) ab
560 nm dazwischen geschaltet, um die Emission des EGFP (Maximum bei 506
nm) von der des mRFP (Maximum bei ungefähr 612 nm) unterscheiden zu
können. Das verwendete Objektiv war ein C-Apochromat 63x/1.2W corr von Zeiss.
Das Pinhole wurde, je nach gewünschter Intensität und Schichtdicke, auf eine
Fokusebene zwischen 100 µm und 140 µm eingestellt.
Die so entstandenen Bilder zeigen die zelluläre Verteilung der Proteine mit
angehängtem
Fluoreszenzfarbstoff.
Wurden
zwei
verschiedene
Proteine
verwendet, so konnte ihre Lokalisation zueinander mit Hilfe der vom Computer
errechneten Überlappung der Fluoreszenzsignale (Merge) sichtbar gemacht
2 Material und Methoden
36
werden. Für die Bearbeitung der Konfokalen Bilder wurde der LSM-Image Browser
Version 4.0.0.157 von Zeiss verwendet.
2.2.4 FRET/FLIM/SLIM
FRET
FRET (Förster Resonance Energy Transfer), beschreibt die Übertragung von
Energie zwischen zwei Fluorophoren. Durch den Impuls eines Lasers im
Exzitationsbereich des Donor-Fluorophores, in dieser Arbeit EGFP, kommt es zu
einer Anregung desselben. EGFP emittiert nun Licht in seinem spezifischen
Spektrum. Existiert in unmittelbarer Nähe, dem sogenannten Förster-Radius
(<10 nm) ein Akzeptor, in diesen Experimenten mRFP, so nimmt dieser Teile der
abgegebenen Energie auf und beginnt selbst, Licht in seinem charakteristischen
Spektrum zu emittieren (Abb.11).
Donor
Donor
Acceptor
Absorption Emission Absorption
Excitation
D
D
A
Acceptor
Emission
A
Emission
Wavelength
Abb. 11: Übertragung der Energie von Donor- auf Akzeptor- Fluorophor
(Bedienungsanleitung für SPCImage 2.8, September 2006, Becker und Hickl)
Durch eine Anregung (Excitation) des Donors kommt es zunächst zu einer Absoption der Energie. Dann
emittiert der Donor Licht in seiner charakteristischen Wellenlänge und überträgt gleichzeitig Energie auf den
Akzeptor. Dieser nimmt die Energie auf und emittiert nun auch Licht in seiner spezifischen Wellenlänge.
FRET kann durch verschiedene Methoden nachgewiesen werden. Einmal durch
die Intensitätszunahme der Akzeptoremission. Die unmittelbare Nähe zweier
Fluorophore lässt sich aber auch durch das sogenannte Akzeptor-Bleaching
(Ausbleichen) zeigen, wobei nachgewiesen wird, dass das Donor-Fluorophor nach
bestimmter Zeit wieder eine Emission aufweist. Eine weitere hier verwendete
2 Material und Methoden
37
Methode basiert auf der Messung der Abklingzeit (Lifetime) des Donor-Fluorophor,
dies ist die FRET/FLIM-Methode (Ruck et al. 2007).
FRET/FLIM
Ein Phänomen bei der unmittelbaren Nähe zweier Farbstoffe ist die Abnahme der
Abklingzeit (Lifetime) des Donors. Jeder Fluoreszenzfarbstoff hat eine spezifische
Dauer der Photonenemission (Lifetime). Diese verändert sich abhängig von
verschiedenen Einflüssen wie Konformation oder dem pH in der Umgebung
(Lakowicz et al. 1992). Auch durch das Anhängen eines EGFP an ein Protein wird
die EGFP-Lifetime verändert, weshalb für jedes Experiment eine spezifische
Negativkontrolle zur Etablierung einer Baseline-Lifetime nötig ist. Liegen die
beiden zu untersuchenden Proteine näher als 10nm beieinander, so kommt es zu
dem bereits beschriebenen Energietransfer. Die Übertragung der aufgenommenen
Energie auf einen Akzeptor führt beim Donor Fluorophor zu einer Abnahme der
Lifetime, die auch als Quenching bezeichnet wird (Abb.12).
Abb. 12: Abnahme der Lifetime (Quenching) eines Fluorophores nach Exzitation durch
einen Laser-Impuls durch Energie Transfer (Bedienungsanleitung für SPCImage 2.8,
September 2006, Becker und Hickl)
Diese Abnahme der Lifetime kann gemessen werden und hängt von der
Interaktion der beiden Proteine ab (Chen et al. 2003; Kress et al. 2003; Esposito
und Wouters 2004; Ruck et al. 2007).
2 Material und Methoden
38
Die Vorteile der FRET/FLIM Methode liegen unter anderem darin, dass die
Messungen unabhängig von der Intensität der Exzitation und der Konzentration
der Fluorophore sind (Chen et al. 2003). Ein weiterer Vorteil besteht darin, dass
die Lokalisation der Energieübertragung dargestellt werden kann.
SLIM
Die spektrale Fluorescence Lifetime Imaging Mikroskopie (SLIM), die in dieser
Arbeit verwendet wurde kombiniert eine spektral aufgelöste mit einer zeitlich
aufgelösten Detektion der Fluoreszenz. Die Lifetime wird durch Anpassung an
mono- oder multiexponentiellen Kurven berechnet. Außerdem kann hier durch die
Möglichkeit der spektralen Auflösung in mehreren Kanälen die Anwesenheit des
Akzeptors gesichert werden.
Nach einem kurzen Anregungs-Puls des Lasers werden die einzelnen emittierten
Photonen an den insgesamt 16 Photomultiplier (PMT, Photon multiplier tube)
detektiert.
Diese Ereignisse werden gesammelt und gespeichert. Der TAC (time-to-amplitude
converter) bestimmt die zeitliche Position der Photonen und das Scanning
Interface (mit frame sync, line sync und pixel clock) stellt die örtliche Lokalisation
des Signals fest (Abb.13). Durch diesen Aufbau kann sowohl die Wellenlänge, die
Abklingzeit (Lifetime) und der Ort des Signales bestimmt werden. Es werden
128x128 Pixel ausgewertet und es stehen insgesamt 256 time channels zur
Verfügung, von denen 64 verwendet wurden.
2 Material und Methoden
39
Abb. 13: Schematische Darstellung der Spektralen Lifetime Imaging Microscopy (SLIM)
(Bedienungsanleitung für SPCImage 2.8, September 2006, Becker und Hickl)
Von dem Polychromator über den Detektor wird die Information der Wellenlänge (Wavelength) einem
bestimmten Kanal (Channel) zugeordnet.
Gleichzeitig wird die Abklingzeit (Time within Decay Curve) mit Hilfe des Start-und Stop-Signals des Lasers
gemessen (Time Measurement). Dies wird mithilfe des Time to Amplitude Converter (TAC), Analog Digital
Converter (ADC) und Constant Fraction Discriminator (CFD) bewerkstelligt. Diese Information wird auch dem
jeweiligen Kanal (schematisch sind hier vier dargestellt: blau, grün, gelb und rosa) zugeordnet.
Die Lokalisation des Signals wird vom Mikroskop über den Frame Synchronisator (Sync), Linie Sync und die
Pixel Clock in das Scanning Interface geleitet. Hier wird der eingegangenen Information ein x-Wert und ein yWert zugeordnet und die Information zur Lokalisation auch an den jeweiligen Kanal weitergegeben.
Die Informationen, die man so erhält sind eine Kombination von Wellenlänge, Abklingzeit und Lokalisierung
des Signals.
In den SLIM-Experimenten wurden die im Folgenden beschriebenen Apparaturen
verwendet. Die Anregung erfolgte durch einen Titan-Saphir-Laser (Tsunami,
Spectra Physics) mit einer Wellenlänge von 800 nm, einer Pulsdauer im Bereich
von Femtosekunden und einer Pulswiederholungsrate von 80 MHz. Dadurch, dass
eine
Zwei-Photonen-Anregung
stattfindet,
liegt
die
effektive
Anregungs-
Wellenlänge des Lasers bei 400 nm.
Das TCSPC Module 830/PML/16 (Becker & Hickl), die PMT R5900-01-L16 und
der Spectrograph MS125 (LOT-Oriel) wurden zur Detektion und Auflösung der
Signale verwendet.
2 Material und Methoden
40
2.2.5 Einstellung der Apparaturen
In dieser Arbeit wurde eine Spektrometer Kalibration von 457-633 nm eingesetzt,
um die Emissionsmaxima von EGFP und mRFP abzudecken. Ein Kanal entspricht
somit einer spektralen Breite von 11 nm. Das für das verwendete EGFP
spezifische Emissionsmaximum (506 nm) befindet sich bei dieser Kalibration im
Kanal 11 der insgesamt 16 Kanäle. Die Anwesenheit des mRFP- Akzeptors kann
in den Kanälen 4 bis 6 überprüft werden.
Zunächst wurde die optimale Einstellung des Titan-Saphir-Laser-Pulses und des
Scanmodus anhand einer Versuchsreihe mit EGFP transfizierten Zellen etabliert.
Dies ergab eine optimale Ausbeute an Photonen bei vier Scanzyklen, die jeweils
eine Dauer von 8 Sekunden hatten. Diese Einstellung wurde für alle folgenden
Experimente verwendet.
2.2.6 Auswertung der SLIM Daten mit SPCImage
Die Auswertung der in den SLIM-Experimenten generierten Rohdaten erfolgte mit
dem Programm SPCImage 2.8 von Becker&Hickl, wobei SPC für Single Photon
Counting steht. Das Protokoll zur Auswertungen wurde in den Grundzügen von
Thomas et al. übernommen und für die spezielle Anwendung in einem Modell mit
lebenden Zellen nach Ruck et al. modifiziert. Es wurde im Kanal 11 (506nm)
ausgewertet, da sich dort das Emissionsmaximun des EGFP befindet. Bei jeder
Auswertung
wurden die Grundeinstellungen (Binning: 1, Threshold: 20,
Components: 2) konstant eingehalten und die Optionen Shift bei 1,0 und Scatter
bei 0,4 fixiert. Außerdem wurde darauf geachtet, dass der X²-Wert der errechneten
Kurve den Wert von 2,0 nicht überschreitet und die Photonen-Counts möglichst
hoch liegen (Ruck et al. 2007; Thomas et al. 2008).
Zunächst
wurden
die
Daten
der
Einzeltransfektionen
(Negativkontrolle)
ausgewertet um die Baseline-Lifetime zu errechnen. Dazu wurde bei allen
ausgewerteten Zellen die mittlere Lifetime ermittelt (tm). Der Mittelwert der tm
wurde errechnet und nun bei nochmaliger Auswertung der Negativkontrollen als t2
eingesetzt und fixiert. Die Werte für die t1-Werte wurden nun ausgerechnet. Bei
den Negativkontrollen soll der t1-Wert sich von dem t2-Wert bei einer
biexponentiellen Kurvenauswertung nur minimal unterscheiden, da die längste und
2 Material und Methoden
41
kürzeste Lifetime in diesem Experiment ohne FRET bis auf kleine Schwankungen
abhängig von der Umgebung des Fluorophores, den gleichen Wert annehmen.
Der Mittelwert sämtlicher t1-Werte der Negativkontrolle wird nun für die
Auswertung der Kotransfektionen verwendet und als t2-Wert fixiert. Hier wird nun
auch wieder der t1-Werte bestimmt. Bei einer Interaktion von zwei Proteinen stellt
dieser Wert sich, im Gegensatz zum
t1-Wert der Negativkontrollen, deutlich
erniedrigt dar.
Die im Folgenden dargestellten, repräsentativen Bilder einzelner Zellen der
SLIM- Experimente bestehen aus zwei Komponenten. Die schwarzweißen Bilder
auf der jeweils linken Seite zeigen das sogenannte Intensity Image. Hier wird ein
Pixel umso heller dargestellt, je mehr Photonen in ihm detektiert werden. An einer
schwarzen Stelle im Bild findet keinerlei Exzitation von Fluorophoren statt, an
einer sehr hellen Stelle umso mehr. Durch diese Darstellung kann man auf die
Verteilung der Proteine mit angehängtem Fluoreszenzfarbstoff schließen. Die
jeweils zweite Reihe der Bilder ist farbkodiert. Sie entstehen durch die
Informationen des Intensity Images in Kombination mit der Farbinformation von
einem
gewählten
Parameter,
dessen
Werte
durch
eine
kontinuierliche
Fehlfarbenskala kodiert werden. In diesem Fall wurde die Farbskala einem
Lifetime-Wert in Pikosekunden (ps) von 1400 ps (orange) bis 2200 ps (blau)
zugeordnet. Durch diese Kodierung lässt sich auf jedem Bild schnell erkennen, wo
in der Zelle welche Lifetimes vorhanden sind. Ein Unterschied zwischen den
verschiedenen Transfektionsansätzen kann anhand dieser Bilder verdeutlicht
werden. Die in diesem Zusammenhang angegebenen Lifetime-Werte in
Pikosekunden entsprechen den Werten, die anhand der Fehlfarbenkodierungen
des jeweiligen Bildes abgelesen werden können und sollen ausschließlich zur
Darstellung der einzelnen Zelle dienen. Für die absoluten Werte darf auf die
statistische Auswertung der Experimente verwiesen werden.
2.3 Statistische Methoden
Die statistische Auswertung der SLIM-Experimente erfolgte mit den Programmen
SigmaStat und SigmaPlot. Anhand der Daten wurde ein BoxPlot erstellt, bei dem
die Box den Bereich zwischen der 25ten und der 75ten Percentile darstellt und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender
2 Material und Methoden
42
unverbundener Test durchgeführt, da zwei unabhängige Gruppen miteinander
verglichen wurden, bei denen nicht von einer Normalverteilung der Werte
ausgegangen werden konnte (Mann-Whitney Rank Sum Test). Die Signifikanz der
Abweichungen der Lifetimes zwischen Kontrolle und Experiment wurde anhand
der p-Werte mit Sternchen gekennzeichnet (p<0,05 ist signifikant=*, p<0,01 ist
sehr signifikant=** und p<0,001 ist höchst signifikant=***). Eine errechnete
Signifikanz bei dieser Testung zeigt eine deutliche Tendenz auf, darf aber nicht als
statistisch beweisend interpretiert werden.
3 Ergebnisse
43
3 Ergebnisse
3.1 Ergebnisse Konfokale Laserscanning Mikroskopie
Mit der Methode der Konfokalen Laserscanning Mikroskopie wurde zunächst ein
Überblick über die Lokalisierung der Proteine BACE, GGA1, GGA2 und GGA3 in
lebenden
Zellen
verschafft.
Des
Weiteren
wurde
durch
entsprechende
Kotransfektionen untersucht, ob sich die Lokalisation der Proteine durch die
Anwesenheit des potentiellen Interaktionspartners verändert. Schließlich wurde
durch computergestützte Aufarbeitung der gewonnenen konfokalen Bilder der
Frage nachgegangen, ob die Proteine in den Zellen kolokalisieren.
Es wurde mit den bereits beschriebenen zwei Zellinien N2A und U373 gearbeitet.
Sämtliche Experimente wurden in beiden Zellinien durchgeführt, aus Gründen der
Übersichtlichkeit sollen hier aber nur repräsentative Bilder gezeigt werden. Die
Zellen wurden mit der entsprechend klonierten Plasmid-DNA transfiziert, die für
die
zu
untersuchenden
Fluoreszenzfarbstoff
Proteine
kodiert.
Es
mit
jeweils
wurden
einem
angehängten
Einzeltransfektionen
und
Kotransfektionen durchgeführt.
Lokalisation von GGAs in U373-Zellen
Zunächst wurde untersucht, wo in der lebenden Zelle die Mitglieder der GGAFamilie lokalisiert sind und ob sich ihre Lokalisation untereinander unterscheidet,
was auf einen Unterschied in der Funktion der verschiedenen GGAs hinweisen
könnte. Die Ergebnisse der Einzeltransfektionen ergaben keinen Unterschied zu
den Kotransfektionen und sollen aus Gründen der Übersichtlichkeit hier nicht
gezeigt werden. Die durchgeführten Transfektionen sind in Tabelle 13 dargestellt.
3 Ergebnisse
44
Tabelle 13: Transfektionsansatz: Lokalisation der GGAs
Einzeltransfektion
Kotransfektionspartner
GGA1-mRFP
−
GGA2-EGFP
GGA3-EGFP
GGA2-mRFP
−
GGA1-EGFP
GGA3-EGFP
GGA3-mRFP
−
GGA1-EGFP
GGA2-EGFP
Die Lokalisation von GGA1-mRFP in lebenden Zellen zeigt in der Konfokalen
Lasermikroskopie eine hauptsächlich perinukleäre Verteilung (1b, 2b Abb.14).
GGA1-EGFP stellt sich entsprechend dar und wird deshalb hier nicht abgebildet.
Es lassen sich auch einzelne Vesikel in der Peripherie erkennen, die GGA1
enthalten. GGA2 hat sowohl als mRFP-Variante, als auch als EGFP-Variante sein
Hauptvorkommen im Gebiet in unmittelbarer Nähe des Zellkerns (1a, 3b Abb.14).
GGA3
entspricht auch
diesem
Verteilungsmuster
(2a,
3a
Abb.14).
Bei
Überlappung des roten und des grünen Kanals kommt es in allen Fällen zu einer
Überlagerung der Signale von mRFP und EGFP (1c, 2c, 3c Abb.14). Daraus folgt,
dass alle drei GGA-Proteine in der lebenden Zelle in unmittelbarer Nähe
nebeneinander liegen und somit kolokalisieren.
3 Ergebnisse
45
1a
1b
1c
2a
2b
2c
3b
3c
3a
Abb. 14: Lokalisation und Kolokalisation GGA1, GGA2 und GGA3 in U373-Zellen in der
Konfokalen Laserscanning Mikroskopie
1a: Grüner Kanal: GGA2-EGFP, Lokalisierung: vor allem perinukleär
1b: Roter Kanal: GGA1-mRFP, Lokalisierung: perinukleär und in peripheren Vesikeln
1c: Merge: Übereinanderlagerung der beiden Kanäle, Übereinstimmung der Lokalisation
2a: Grüner Kanal: GGA3-EGFP, Lokalisierung: perinukleär
2b: Roter Kanal: GGA1-mRFP, Lokalisierung: perinukleär und in peripheren Vesikeln
2c: Merge: Übereinanderlagerung der beiden Kanäle, Übereinstimmung der Lokalisation
3a: Grüner Kanal: GGA3-EGFP, Lokalisierung: perinukleär
3b: Roter Kanal: GGA2-mRFP, Lokalisierung: perinukleär
3c: Merge: Übereinanderlagerung der beiden Kanäle, Übereinstimmung der Lokalisation
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, EGFP:
Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein
3 Ergebnisse
46
Kolokalisation von GGAs mit BACE
Zunächst wurde die Lokalisation von BACE in lebenden Zellen untersucht.
Daraufhin wurde mit Hilfe einer Kotransfektion festgestellt, ob sich die Lokalisation
ändert, wenn die potentiellen Interaktionspartner GGA1, GGA2 und GGA3
anwesend sind. Schließlich wurde untersucht, ob sämtliche Mitglieder der GGAFamilie mit BACE in einem lebenden Zellmodell kolokalisieren. Hierzu wurden die
Zellen mit folgender Plasmid-DNA transfiziert:
Tabelle 14: Transfektionsansatz: Kolokalisation von GGAs mit BACE
Einzeltransfektion
Kotransfektionspartner
BACE-EGFP
−
GGA1-mRFP
GGA2-mRFP
GGA3-mRFP
GGA1-EGFP
−
BACE-mRFP
GGA2-EGFP
−
BACE-mRFP
GGA3-EGFP
−
BACE-mRFP
Die Lokalisationen der Proteine bei einer Kotransfektion veränderte sich
gegenüber der einer Einzeltransfektion nicht. Im Folgenden sollen repräsentative
Bilder
aus
beiden
Zellinien
mit
verschiedenen
Fluoreszenzfarbstoffkombinationen dargestellt werden (Abb.15).
Protein-
und
3 Ergebnisse
47
1a
1b
1c
2a
2b
2c
3a
3b
3c
Abb. 15: Lokalisation und Kolokalisation von GGA1, GGA2 und GGA3 mit BACE in N2AZellen und U373-Zellen in der Konfokalen Laserscanning Mikroskopie
1a: Grüner Kanal: GGA1-EGFP
1b: Roter Kanal: BACE-mRFP
1c: Merge: deutliche Überlappung der Fluoreszenzsignale in der Zelle (U373-Zellinie)
2a: Grüner Kanal: GGA2-EGFP
2b: Roter Kanal: BACE-mRFP
2c: Merge: Überlappung der Fluoreszenzsignale in der Zelle (N2A-Zellinie)
3a: Grüner Kanal: GGA3-EGFP
3b: Roter Kanal: BACE-mRFP
3c: Merge: Teilweise Überlappung der Fluoreszenzsignale in der Zelle (N2A-Zellinie)
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein
3 Ergebnisse
48
Aus den Bildern der Konfokalen Laserscanning Mikroskopie wird deutlich, dass
GGA1 sowohl mit EGFP als auch mit mRFP als Fluoreszenzfarbstoff eine
Lokalisation in der Zelle annimmt, die mit der von BACE größtenteils
übereinstimmt. Die beiden Proteine zeigen ihre Verteilung in zellulären
Kompartimenten,
die
aufgrund
ihrer
Lokalisation
als
Golgi-Apparat
und
Endoplasmatisches Retikulum (ER) interpretiert werden können (Abb.15). Die
Verteilung von BACE verändert sich bei einer gleichzeitigen Überexpression von
GGA1 nicht. Bei Koexpression von GGA1 mit BACE kann man eine deutliche
Überlappung der Signale von mRFP und EGFP beobachten (1c Abb.15). Auch
GGA2 zeigt eine Überlappung der Fluoreszenz mit BACE (2c Abb.15). In den
konfokalen Bildern dieser Kombinationen zeigen sich zusätzlich kleinere
vesikuläre Strukturen in der Zellperipherie, die beiden Proteine beinhalten und als
Endosomen interpretiert werden können. GGA3 und BACE zeigen in der
Überlappung (Merge) des roten und des grünen Kanals auch eine Kolokalisation
der beiden Proteine (3c Abb.15).
Zusammenfassend lässt sich aus diesem Experiment sagen, dass keines der
exprimierten GGA-Proteine die Lokalistion von BACE maßgeblich verändert und
dass alle drei GGAs in den in der Literatur beschriebenen zellulären
Kompartimenten mit BACE zusammen vorliegen und somit kolokalisieren.
Lokalisation von ∆-VHS-GGAs und BACE
Nachdem gezeigt werden konnte, dass GGA1, GGA2 und GGA3 mit BACE
kolokalisieren, wurde die Rolle der VHS-Domäne näher beleuchtet. Diese wurde in
vitro als Bindungsdomäne für BACE erkannt. Es soll untersucht werden, ob die
Abwesenheit der VHS-Domäne einen Einfluß auf die Lokalisation der
GGA-Proteine hat und ob sich das Bild der Kolokalisation mit BACE verändert. Zu
diesem Zweck wurden GGA-Plasmide kloniert, die keine VHS-Domäne (∆VHS)
besitzen. Folgende Transfektionen wurden durchgeführt:
3 Ergebnisse
49
Tabelle 15: Transfektionsansatz: ∆-VHS-GGAs und BACE
Einzeltransfektion
Transfektionspartner
BACE-mRFP
−
GGA1-∆VHS-EGFP
GGA2-∆VHS-EGFP
GGA3-∆VHS-EGFP
Bei der Einzeltransfektion von BACE-mRFP ließ sich die charakteristisch und
bereits beschriebene Verteilung des Proteins in der Zelle feststellen (Abb.16).
Abb. 16: BACE -mRFP Einzeltransfektion
Die alleinige Überexpression von BACE-mRFP zeigt die charakteristische Verteilung des Proteins in
perinukleären Kompartimenten und in vesikulären Strukturen in der Zellperipherie.
Abkürzungen: BACE: β- Amyloid- Cleaving Enzym, mRFP: modifiziertes Red Fluorescent Protein
Bei der gleichzeitigen Transfektion mit GGA1-EGFP ohne seine VHS-Domäne
(GGA1-∆VHS-EGFP) zeigt sich bei dem Übereinanderlegen der Farbkanäle
(Merge), dass die Kolokalisation der beiden Proteine deutlich schwächer
ausgeprägt ist, als bei den vorangegangenen Experimenten mit einem Wildtyp
GGA1-Protein (1c Abb.17). Auch bei GGA2-∆VHS
und BACE wird dieses
Phänomen sichtbar (2c Abb.17). Obwohl die beiden Proteine in ähnlichen
Kompartimenten
lokalisiert
Kolokalisation statt.
zu
sein
scheinen,
findet
keine
ausgeprägte
3 Ergebnisse
50
1a
1b
1c
2a
2b
2c
3a
3b
3c
Abb. 17: Lokalisation und Kolokalisation von ∆- VHS-GGA1, ∆-VHS-GGA2, ∆-VHS-GGA3 mit
BACE in U373-Zellen in der Konfokalen Laserscanning Mikroskopie
1a: Grüner Kanal: GGA1-∆VHS-EGFP
1b: Roter Kanal: BACE-mRFP
1c: Merge: nur geringe Überlappung der Fluoreszenzsignale perinukleär, es zeigen sich viele
Vesikel, die nur BACE-mRFP enthalten
2a: Grüner Kanal: GGA2-∆VHS-EGFP
2b: Roter Kanal: BACE-mRFP
2c: Merge: schwache Überlappung der Lokalisation der beiden Proteine perinukleär
3a: Grüner Kanal: GGA3-∆VHS-EGFP
3b: Roter Kanal: BACE-mRFP
3c: Merge: fast keinerlei Übereinstimmung der Fluoreszenzsignale ersichtlich
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein
3 Ergebnisse
51
Bei der Kotransfektion von GGA3-∆VHS und BACE lässt sich dies auch
beobachten (3c Abb.17). Ohne ihre VHS-Domäne scheinen die GGA-Proteine
eine geringere Kolokalisation mit BACE einzugehen. Ihre Verteilung in der Zelle
konzentriert sich zwar hauptsächlich auf perinukleäre Kompartimente, allerdings
wird auch ein Vorkommen in zytoplasmatischen Bereichen sichtbar.
Lokalisation von BACE(LL499/500AA) mit GGAs
Ein weiterer Ansatzpunkt für die Überprüfung der Lokalisation und Kolokalisation
der
GGA-Proteine
mit
BACE
war
ein
Aminosäuren
Austausch
in
der
Bindungsstelle von BACE unter Entstehung der folgenden BACE-Variante:
LL499/500AA
(von
Arnim
et
al.
2004).
Diese
BACE
Mutante,
die
proteinbiochemisch an isolierten Proteinen nicht in der Lage ist, eine Bindung zur
VHS-Domäne der GGAs aufzubauen (He et al. 2002) und eine Interaktion somit
unmöglich macht, wurde in den folgenden Experimenten verwendet. Folgende
Transfektionen wurden durchgeführt:
Tabelle 16: Transfektionsansatz: BACE(LL499/500AA) mit GGAs
Einzeltransfektion
Kotransfektionspartner
BACE(LL499/500AA)-EGFP
−
GGA1-mRFP
GGA2-mRFP
GGA3-mRFP
3 Ergebnisse
52
Um zunächst einen Eindruck von der Verteilung der mutierten BACE-Variante zu
bekommen, wurde diese in einer Einzeltransfektion untersucht.
Abb. 18: BACE(LL499/50AA)-EGFP Einzeltransfektion
Abkürzungen: BACE: β- Amyloid- Cleaving Enzym, EGFP: Enhanced Green Fluorescent Protein
Die alleinige Überexpression der BACE-Variante (BACE(LL499/500AA)-EGFP)
zeigte eine leicht veränderte, wenn auch ähnliche Verteilung im Vergleich zur
Wildtyp BACE-Variante. Zusätzlich zur Verteilung in Zellkompartimenten, die als
Golgi-Apparat, Endosome und ER interpretiert werden können, scheint eine
ausgeprägtere Verteilung in der Zellperipherie zu existieren (Abb.18). Bei genauer
Betrachtung stellt sich auch ein Vorkommen in direkter Nähe der Zellmembran
dar. BACE(LL499/500AA) lokalisiert größtenteils entsprechend der Wildtyp BACEVariante, es gibt allerdings einige einzelne Proteine, die ihre angestammte
Position in der Zelle nicht mehr zu erreichen scheinen. Trotz mutierter DXXLLSequenz kommt es zur eindeutigen Kolokalisation mit den GGA-Proteinen
(Abb.19).
3 Ergebnisse
53
1a
1b
1c
2a
2b
2c
3a
3b
3c
Abb. 19: Lokalisation und Kolokalisation von GGA1, GGA2 und GGA3 mit
BACE(LL499/500AA) in U373-Zellen in der Konfokalen Laserscanning Mikroskopie
1a: Grüner Kanal: BACE(LL499/500AA)–EGFP
1b: Roter Kanal: GGA1-mRFP
1c: Merge: Teilweise Überlappung der Fluoreszenzsignale im perinukleären Bereich
2a: Grüner Kanal: BACE(LL499/500AA) –EGFP
2b: Roter Kanal: GGA2-mRFP
2c: Merge: Minimale Überlappung der Fluoreszenzsignale
3a: Grüner Kanal: BACE(LL499/500AA) –EGFP
3b: Roter Kanal: GGA3-mRFP
3c: Merge: Teilweise Überlappung der Fluoreszenzsignale
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein
3 Ergebnisse
54
Bei der Kotransfektion mit GGA1 ändert sich auch hier die Verteilung von BACE
nicht, bei einer Übereinanderlegung des roten und des grünen Kanals (Merge)
kommt
es
allerdings
zu
einer
abgeschwächten
Überlagerung
der
Fluoreszenzsignale der beiden Proteine (1c Abb.19). Bei GGA2 und BACE lässt
sich dieses Phänomen besonders gut beobachten (2c Abb.19). Hier sieht man nur
noch eine minimale Überlappung der Signale, obwohl die intrazelluläre Verteilung
der beiden Proteine nahezu unverändert bleibt. Auch bei GGA3 und der vermutlich
bindungsunfähigen BACE-Variante kommt es nur noch zur vereinzelten
Signalüberlappung beim Übereinanderlegen der Kanäle (3c Abb.19). Außerdem
kann beobachtet werden, dass eine Kolokalisation mit den GGA- Proteinen zwar
noch stattfindet, aber etwas schwächer ausgeprägt ist als bei dem Wildtyp
BACE-Protein.
3.2 Ergebnisse Spektrales Fluorescence Lifetime Imaging
3.2.1 Fokus auf GGA-Proteine und ihre VHS-Domäne
Um die vielversprechenden Ergebnisse hinsichtlich der Kolokalisation von BACE
mit den GGAs in der Konfokalen Laserscanning Mikroskopie zu bestätigen und zu
überprüfen, wurde die Methode des Spektralen Fluorescence Lifetime Imaging
(SLIM) angewendet.
Mit dieser Methode wird durch eine Abnahme der Lifetime des
Donor-Fluorophores die Nähe zweier Proteine von weniger als 10 nm
nachgewiesen und damit eine Interaktion wahrscheinlich. An jedem Messtag
wurde ein Zellschälchen mit EGFP-Plasmid DNA transfiziert und ein weiteres mit
EGFP-mRFP-Tandem DNA zur Kalibrierung des Gerätes und zum Nachweis,
dass eine Abnahme der Lifetime auch tatsächlich nachgewiesen werden kann. Als
Negativkontrolle wurde jeweils das mit EGFP getaggte Protein in einer
Einzeltransfektion herangezogen. Um die VHS-Domäne als Bindungsstelle
zwischen BACE und den GGAs zu bestätigen, wurde ein Plasmid erstellt, in dem
die VHS-Domäne eliminiert wurde. Die Daten der SLIM- Experimente werden
sowohl als repräsentative Bilder dargestellt als auch statistisch ausgewertet.
Von den verschiedenen Messtagen soll hier und auch im Folgenden jeweils nur
einer exemplarisch dargestellt werden. Die n-Zahl bezieht sich auf die Anzahl der
3 Ergebnisse
55
ausgewerteten Zellen pro Transfektionsansatz. Es wurden pro Zelle 128x128 Pixel
ausgewertet und die Anzahl von detektierten Photonen lag in der Regel über
10000.
Die Bilder und Messungen wurden sowohl in N2A-Zellen als auch in U373-Zellen
aufgenommen und durchgeführt. Hier sollen nun die Bilder und Auswertungen in
U373-Zellen, die sich durch eine bessere Transfektionseffizienz und bessere
Resistenz gegenüber der Toxizität der Transfektionsreagenz ausgezeichnet
haben, dargestellt werden.
Die erste Versuchsreihe beinhaltete neben den Kontrolltransfektionen mit EGFP
und einem EGFP-mRFP-Tandem folgende Plasmid-DNA:
Tabelle 17: Transfektionsansatz: SLIM Experimente mit ∆VHS-GGAs als Kontrolle
Einzeltransfektion
Kotransfektionspartner
GGA1-EGFP
−
GGA2-EGFP
−
GGA3-EGFP
−
BACE-mRFP
GGA1-EGFP
GGA2-EGFP
GGA3-EGFP
GGA1-∆VHS-EGFP
GGA2-∆VHS-EGFP
GGA3-∆VHS-EGFP
GGA1 und BACE
Die Auswertung der Daten der Einzeltransfektion von GGA1-EGFP und den
Kotransfektionen von BACE-mRFP mit GGA1-EGFP oder GGA1-∆VHS-EGFP
ergab eine eindeutige Abnahme der Lifetime bei der Kotransfektion von BACEmRFP mit GGA1-EGFP (Abb.20).
Lifetime (ps)
3 Ergebnisse
56
2400
***
***
2200
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 20: Statistik: GGA1 (Wildtyp und als ∆-VHS-Variante) und BACE
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummentest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von GGA1-EGFP (n=14), Median 1797 ps (1728 ps/2003 ps)
2 (rot): Kotransfektion von GGA1-EGFP mit BACE-mRFP (n=15), Median 1571 ps (1542 ps/1708 ps)
3 (blau): Kotransfektion von GGA1-∆VHS-EGFP mit BACE-mRFP (n=18),
Median 1789 ps (1729 ps/1818 ps)
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
GGA1-EGFP (n=14), dargestellt in der grünen Box, zeigt einen Median von 1797
ps (1728 ps/2003 ps), die Werte in Klammern entsprechen der 25ten
beziehungsweise 75ten Perzentile. Das bedeutet, dass die Lifetime von GGA1EGFP ohne potentiellen Interaktionspartner bei ungefähr 1800 ps liegt. GGA1EGFP kotransfiziert mit BACE-mRFP (n=15), rot hervorgehoben, hat einen Median
von 1571 ps (1542 ps/1708 ps). Dies ist eine deutliche Abnahme der Lifetime und
3 Ergebnisse
57
deutet damit auf eine Interaktion zwischen dem BACE-Protein und GGA1 hin.
GGA1-∆VHS-EGFP kotransfiziert mit BACE-mRFP (n=18), in blau, zeigt einen
Median von 1789 ps (1729 ps/1818 ps). Durch Entfernung der VHS-Domäne und
damit der potentiellen Bindungsstelle zu BACE wird die Lifetime auch bei
Kotransfektion
mit
BACE-mRFP
nicht
wesentlich
verändert.
Durch
die
Durchführung des Rangsummentests nach Mann-Whitney zeigt sich, dass die
Abnahme der Lifetime bei Kotransfektion von GGA1-EGFP mit BACE-mRFP
sowohl im Vergleich zur Einzeltransfektion von GGA1-EGFP, als auch zur
Kotransfektion von GGA1-∆VHS-EGFP mit BACE-mRFP statistisch höchst
signifikant ist.
Bei dem entsprechenden Vergleich von GGA1-EGFP mit der
Kotransfektion von GGA1-∆VHS-EGFP mit BACE-mRFP konnte keine statistisch
relevante Abweichung des Lifetime-Wertes festgestellt werden.
Um die statistischen Werte zu veranschaulichen werden nun repräsentative Bilder
von Zellen gezeigt, in denen sowohl das Phänomen der Lifetime-Abnahme als
auch die Lokalisation dieses Vorgangs zu sehen ist.
3 Ergebnisse
58
1a
1b
1c
2a
2b
2c
Lifetime: 1400ps
2200ps
Abb. 21: Repräsentative Zellen: GGA1 (Wildtyp und als ∆-VHS-Variante) und BACE
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: GGA1-EGFP
1b: GGA1-EGFP mit BACE-mRF
1c: GGA1-∆VHS-EGFP mit BACE-mRFP
Reihe 2: : Farbkodierte Bilder, die mit den „Intensity Images“ übereinandergelegt wurden, in denen
die gemessene Lifetime in Pikosekunden (ps) anhand einer Farbskala von 1400 ps
(orange) bis 2200 ps (blau) kodiert wurde
2a: GGA1-EGFP zeigt auf diesem Bild ohne Transfektionspartner eine Lifetime von
circa 1900 ps
2b: GGA1-EGFP mit BACE-mRFP, das Wildtype GGA1-Proteine zeigt hier bei der
Kotransfektion mit BACE eine Abnahme der Lifetime auf circa 1600 ps
2c: GGA1-∆VHS-EGFP mit BACE-mRFP, die GGA1-Variante ohne VHS-Domäne zeigt auf
diesem Bild bei der Kotransfektion mit BACE weiterhin eine Lifetime von circa 1900 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
3 Ergebnisse
59
Die Transfektion von GGA1-EGFP alleine (1a und 2a, Abb.21) zeigt die
charakteristische Verteilung des Proteins, wie sie auch schon in den Bildern der
Konfokalen Laserscanning Mikroskopie Technik zu erkennen waren.
Eine deutliche Veränderung zeigt sich allerdings in 1b und 2b der Abb.21. Bei der
gemeinsamen Transfektion der Wildtyp Variante des GGA1-EGFP-Proteins mit
BACE-mRFP lässt sich eine deutliche Reduktion der Lifetime im farbkodierten Bild
erkennen.
Die Kotransfektion von GGA1-∆VHS-EGFP und BACE-mRFP (1c und 2c, Abb.21)
stellt sich ähnlich dar. Beide Proteine befinden sich in ihren entsprechenden
Zellkompartimenten und nahe beieinander. Wirft man allerdings einen Blick auf die
Farbkodierung kann man erkennen, dass sich die Farben im Zellkörper im
Vergleich zu der Einzeltransfektion von GGA1-EGFP nicht verändert haben.
Daraus lässt sich folgern, dass es trotz einer räumlichen Nähe der beiden Proteine
nicht zu einer Energie-Übertragung vom Donor- auf das Akzeptor-Fluorophor
kommt.
GGA2 und BACE
Um die Ergebnisse aus den Experimenten mit GGA1 und BACE auch für das
zweite Mitglied der GGA-Familie (GGA2) zu überprüfen, wurden auch hier die
Daten der Einzeltransfektion sowie Kotransfektionen von GGA2-EGFP mit BACEmRFP und GGA2-∆-VHS-EGFP mit BACE-mRFP ausgewertet (Abb.22).
Lifetime (ps)
3 Ergebnisse
60
2400
***
***
2200
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 22: Statistik: GGA2 (Wildtyp und als ∆-VHS-Variante) und BACE
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummenest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von GGA2-EGFP (n=12), Median 1900 ps (1829 ps/1981 ps)
2 (rot): Kotransfektion von GGA2-EGFP mit BACE-mRFP (n=17), Median 1710 ps (1596 ps/1771 ps)
3 (blau): Kotransfektion von GGA2-∆VHS-EGFP mit BACE-mRFP (n=21),
Median 1848 ps (1793 ps/ 1882 ps)
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Die in grün dargestellte Baseline-Lifetime des GGA2-EGFP mit einem Median von
1900 ps reduziert sich bei Kotransfektion mit BACE-mRFP statistisch höchst
signifikant auf einen medianen Wert von 1710 ps (rote Box). Um eine zufällige
Abnahme der Lifetime auszuschließen und um die Relevanz der VHS-Domäne
auch bei GGA2 zu bestätigen wurde die Kotransfektion von GGA2-∆-VHS-EGFP
mit BACE-mRFP ausgewertet. Hier zeigt sich eine statistisch höchst signifikante
3 Ergebnisse
61
Abweichung des Lifetime-Wertes gegenüber der gemeinsamen Transfektion von
GGA2-EGFP mit BACE-mRFP. Der Median im Experiment ohne die VHS-Domäne
liegt bei 1848 ps und damit nahe an der Baseline-Lifetime von GGA2-EGFP in der
Einzeltransfektion.
Um
die
Lokalisierung
dieses
Phänomens
zu
verdeutlichen
und
zu
veranschaulichen werden nun einige repräsentative Zellbilder dargestellt (Abb.23).
Auch bei der Betrachtung des zweiten Mitglieds der GGA-Familie (GGA2) zeigt
sich ein ähnliches Bild wie es sich bereits bei GGA1 geboten hat. Bei der
Einzeltransfektion liegt das Protein im Bereich um den Zellkern und auch die
Lifetime in der Farbkodierung hält sich im Bereich um die 1900 ps auf (1a und 2a,
Abb.24). Im Randbereich der zur blauen Kodierung gehörenden Zellanteile lassen
sich auch vereinzelt einige kürzere Lifetimes erkennen, die in der Farbkodierung
grünlich und in einem Ausnahmefall auch rot und damit deutlich unter dem
erwarteten Pikosekundenwert für dieses Experiment liegen. Die Transfektion von
GGA2-EGFP mit BACE-mRFP (1b und 2b, Abb.23) zeigt im Gegensatz zur
Transfektion von GGA2-∆VHS-EGFP mit BACE-mRFP (1c und 2c, Abb.23) wieder
eine verringerte Lifetime im grünen Bereich bei ungefähr 1600 ps.
3 Ergebnisse
62
1a
1b
1c
2a
2b
2c
Lifetime:
1400ps
2200ps
Abb. 23: Repräsentative Zellen: GGA2 (Wildtyp und als ∆-VHS-Variante) und BACE
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: GGA2-EGFP
1b: GGA2-EGFP mit BACE-mRFP
1c: GGA2-∆VHS-EGFP mit BACE-mRFP
Reihe 2: Farbkodierte Bilder, die mit den „Intensity Images“ übereinandergelegt wurden, in denen
die gemessene Lifetime in Pikosekunden (ps) anhand einer Farbskala von 1400 ps
(orange) bis 2200 ps (blau) kodiert wurde
2a: GGA2-EGFP zeigt in dieser Zelle ohne Transfektionspartner eine Lifetime von circa
1900 ps
2b: GGA2-EGFP mit BACE-mRFP, das Wildtype GGA2-EGFP Protein zeig in dieser Zelle bei
der Kotransfektion mit BACE-mRFP eine Abnahme der Lifetime auf circa 1600 ps
2c: GGA2-∆VHS-EGFP mit BACE-mRFP, die GGA2-EGFP Variante ohne VHS-Domäne
zeigt in dieser repräsentativen Zelle bei der Kotransfektion mit BACE-mRFP weiterhin
eine Lifetime von circa 1900 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
3 Ergebnisse
63
GGA3 und BACE
Auch bei GGA3, dem letzten untersuchten Mitglied der GGA-Familie in diesem
Experimentaufbau, lässt sich der Unterschied in der Lifetime zwischen Kontrolle
und Experiment deutlich erkennen (Abb.24). Die in grün dargestellte Lifetime von
GGA3-EGFP in der Einzeltransfektion hat einen Median von 1862 ps. Bei der
Kotransfektion mit BACE-mRFP (rot), nimmt die LIfetime deutlich und statistisch
höchst signifikant ab und liegt nun bei ungefähr 1615 ps. Durch die Elimination der
VHS-Domäne im GGA3-Protein kann dieses Phänomen wieder rückgängig
gemacht werden (blau). Der Median der Lifetime von 1843 ps dieser Kombination
unterscheidet sich statistisch nicht von der Baseline-Lifetime des GGA3-EGFP.
Lifetime (ps)
3 Ergebnisse
64
2400
2200
***
***
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 24: Statistik: GGA3 (Wildtyp und als ∆-VHS-Variante) und BACE
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummentest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von GGA3-EGFP (n=18), Median 1862 ps (1829 ps/ 1981 ps)
2 (rot): Kotransfektion von GGA3-EGFP mit BACE-mRFP (n=16),Median 1615 ps (1571 ps/1721 ps).
3 (blau): Kotransfektion von GGA3-∆VHS-EGFP mit BACE-mRFP (n=17),
Median 1843 ps (1786 ps/ 1915 ps).
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Um den Vorteil der SLIM-Methode, die simultane Darstellung der Lokalisation von
FRET-Phänomenen, ausnutzen zu können werden im Folgenden repräsentative
Zellen zu dieser statistischen Auswertung abgebildet (Abb.25).
3 Ergebnisse
65
1a
1b
1c
2a
2b
2c
Lifetime: 1400ps
2200ps
Abb. 25: Repräsentative Zellen: GGA3 (Wildtyp und als ∆-VHS-Variante) und BACE
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: GGA3-EGFP
1b: GGA3-EGFP mit BACE-mRFP
1c: GGA3-∆VHS-EGFP mit BACE-mRFP GGA3-EGFP mit BACE-mRFP
Reihe 2: : Farbkodierte Bilder, die mit den „Intensity Images“ übereinandergelegt wurden, in denen
die gemessene Lifetime in Pikosekunden (ps) anhand einer Farbskala von 1400 ps (orange) bis
2200 ps (blau) kodiert wurde
2a: GGA3-EGFP zeigt ohne Transfektionspartner eine Lifetime von circa 2100 ps
2b: GGA3-EGFP mit BACE-mRFP, das Wildtype GGA3-Proteine zeigt bei der Kotransfektion mit BACE
eine Abnahme der Lifetime auf circa 1600 ps
2c: GGA3-∆VHS-EGFP mit BACE-mRFP, die GGA3-Variante ohne VHS-Domäne zeigt bei
der Kotransfektion mit BACE eine Lifetime von circa 1900 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Durch die Abbildung 25 wird deutlich, dass auch bei GGA3 eine Kotransfektion mit
BACE zu einer Reduktion der Lifetime führt, die an den farbcodierten Bildern
3 Ergebnisse
66
deutlich zu erkennen ist. Bei deletierter VHS-Domäne des GGA3-Proteins lässt
sich dieses Phänomen allerdings nicht mehr beobachten. Es zeigt sich hier, dass
auch GGA3 zu einer Interaktion mit BACE die VHS-Domäne benötigt, da es trotz
der relativen räumlichen Nähe sonst zu einem vernachlässigbar geringerem
Energietransfer zwischen den beiden Proteinen kommt. Dass die beiden Proteine
sowohl bei der Wildtypen GGA3-Variante, als auch bei der ∆VHS-Variante in
ähnlichen Zellkompartimenten liegen lässt dich an den Intensity-Bildern (Reihe 1,
Abb.25) sehen. Die Lokalisation der Proteine unterscheidet sich nicht in dieser
Darstellung.
GGA1-EGFP, GGA2-EGFP und GGA3-EGFP zeigen bei vorhandener VHSDomäne und Kotransfektion mit BACE-mRFP eine deutliche Abnahme der EGFPLifetime, wobei die Lokalisation der Proteine in der Zelle nicht beeinflusst wird. Die
Deletions-Mutanten (∆-VHS) der GGA- EGFP-Proteine zeigten trotz räumlicher
Nähe zu BACE-mRFP keine statistisch signifikante Reduktion der Lifetime.
3.2.2 Fokus auf BACE und das DXXLL-Motiv
Die zweite Versuchsreihe wurde einerseits zur Bestätigung der bereits
gewonnenen Ergebnisse in der Untersuchung der drei GGA-Proteine und BACE,
mit dem Fokus auf die Bedeutung der VHS-Domäne der GGAs, eingesetzt.
Andererseits dienen diese Experimente zur Überprüfung der Rolle des
DXXLL-Aminosäuremotives im BACE-Protein bei der Bindung an die Mitglieder
der GGA-Familie. Zu diesem Zweck wurde eine BACE-Variante mit mutiertem
DXXLL-Motiv kloniert (BACE(LL499/500AA)-EGFP). Diese Variante diente auch
als interne Kontrolle der Experimente, um eine zufällige Abnahme der Lifetime
durch
alleinige
räumliche
Nähe
auszuschließen.
Zusätzlich
zu
den
Kontrolltransfektionen mit EGFP und dem EGFP-mRFP-Tandem zur Bestätigung,
dass eine Energieübertragung zwischen den Fluorophoren tatsächlich detektiert
werden kann, wurden die U373-Zellen mit den folgenden Transfektionsansätzen in
der SLIM-Methode untersucht.
3 Ergebnisse
67
Tabelle 18: Transfektionsansatz: SLIM Experimente mit BACE(LL499/500AA) als Kontrolle
BACE-EGFP
−
GGA1-mRFP
BACE-EGFP
BACE(LL499/500AA)-EGFP
GGA2-mRFP
BACE-EGFP
BACE(LL499/500AA)-EGFP
GGA3-mRFP
BACE-EGFP
BACE(LL499/500AA)-EGFP
GGA1 und BACE oder BACE(LL499/500AA)
In dieser Reihe von Experimenten wurde der grün fluoreszierende Farbstoff EGFP
sowohl an die Wildtyp Variante des BACE-Protein angehängt, als auch an die
mutierte Variante mit dem veränderten Aminosäuremotiv BACE(LL499/500AA).
Die GGA-Proteine wurden mit dem roten Fluoreszenzfarbstoff mRFP versehen.
In der Auswertung der Daten (Abb.26) zeigte sich bei der Einzeltransfektion von
BACE-EGFP (grün) eine Lifetime mit einem Median von 1915 ps (1856 ps/1938
ps). Bei der Transfektion von BACE-EGFP zusammen mit GGA1-mRFP (rot)
reduziert sich die Lifetime statistisch höchst signifikant auf einen Median von 1602
ps (1399 ps/1701 ps). Zur internen Kontrollen, um eine zufällige Reduktion der
Lifetime auszuschließen wurde das Experiment auch mit einer BACE-Version mit
mutiertem DXXLL-Motiv durchgeführt (blau). Es zeigt sich, dass bei dieser
Kombination sich die Lifetime deutlich der Baseline-Lifetime von BACE-EGFP
annähert.
Lifetime (ps)
3 Ergebnisse
68
2400
***
***
2200
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 26: Statistik: GGA1 und BACE (Wildtyp und als LL499/500AA- Variation)
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummentest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von BACE-EGFP (n=37) zeigt einen Median von 1916 ps (1856 ps/1938 ps)
2 (rot): BACE-EGFP kotransfiziert mit GGA1-mRFP (n=15), Median 1602 ps (1399 ps/1701 ps)
3 (blau): BACE(LL499/500AA)-EGFP kotransfiziert mit GGA1-mRFP (n=16) hat einen Median von 1830 ps
(1797 ps/1893 ps).
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Um auch in dieser Reihe von Experimenten eine Momentaufnahme der Situation
in der lebenden Zelle zu gewinnen, werden auch hier einige repräsentative Zellen
abgebildet (Abb.27)
3 Ergebnisse
69
1a
1b
1c
2a
2b
2c
Lifetime: 1400ps
2200ps
Abb. 27: Repräsentative Zellen: GGA1 und BACE (Wildtyp und als LL499/500AA- Variation)
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: BACE-EGFP
1b: BACE-EGFP mit GGA1-mRFP
1c: BACE(LL499/500AA)-EGFP mit GGA1-mRFP
Reihe 2: Farbkodierte Bilder, in denen die gemessene Lifetime in Pikosekunden (ps) anhand einer
Farbskala von 1400 ps (orange) bis 2200 ps (blau) kodiert wurde
2a: BACE-EGFP zeigt ohne Transfektionspartner eine Lifetime von circa 1900 ps
2b: BACE-EGFP mit GGA1-mRFP, das Wildtype BACE-Protein, zeigt bei der Kotransfektion
mit GGA1 eine Abnahme der Lifetime auf circa 1600 ps
2c: BACE(LL499/500AA)-EGFP mit GGA1-mRFP, die BACE-Variante mit mutierter
Bindungsstelle zeigt bei der Kotransfektion mit GGA1-mRFP auch eine Lifetime von circa
1900 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
BACE-EGFP alleine zeigt in der Auswertung der SLIM-Bilder neben seiner
charakteristischen Verteilung in perinukleären Regionen der Zelle, eine konstante
3 Ergebnisse
70
Baseline-Lifetime von circa 1900 ps in der Farbcodierung (1a und 2a, Abb.27). Die
Wildtype Form von BACE mit intakter Bindungssequenz lässt bei der
Kotransfektion mit GGA1 hingegen eine deutliche Reduktion des Lifetime-Wertes
erkennen, während auch hier die Lokalisation der Proteine in der Zelle
unbeeinflusst bleibt (1b und 2b, Abb.27).
Bei
der
Transfektion
der
BACE-Variante
mit
veränderter
Bindungsstelle
zusammen mit GGA1 zeigt sich kaum eine Veränderung sowohl in der Verteilung
der Proteine als auch in der Farbkodierung der Lifetime (1c und 2c, Abb.27). Diese
Beobachtungen bestätigen die Ergebnisse, die zuvor mit BACE-mRFP und GGA1EGFP gezeigt wurden.
GGA2 und BACE oder BACE(LL499/500AA)
Auch die Auswertung der SLIM-Daten von GGA2 als Kotransfektionspartner von
BACE (Wildtyp oder als Mutante) ergab ein ähnliches Ergebnis (Abb.28). Die
Abnahme der Lifetime bei Kotransfektion von BACE-EGFP mit GGA2-mRFP (rot)
gegenüber der Baseline-Lifetime (grün) ist auch bei diesem Experiment statistisch
höchst signifikant. Der Median sinkt von 1916 ps (1856 ps/1938 ps) auf 1660 ps
(1580 ps/1749 ps). Bei Kotransfektion von GGA2-mRFP mit BACE(LL499/500AA)EGFP findet eine Aufhebung dieses Phänomens statt (blau). Die Lifetime hat nun
wieder einen Median von 1802 ps (1766 ps/1921 ps). Der statistische Unterschied
ist sehr signifikant zur Kotransfektion von BACE-EGFP mit GGA2-mRFP (rot).
Lifetime (ps)
3 Ergebnisse
71
2400
**
***
2200
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 28: Statistik: GGA2 und BACE (Wildtyp und als LL499/500AA- Variation)
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummentest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von BACE-EGFP (n=37) zeigt einen Median von 1916 ps
(1856 ps/1938 ps)
2 (rot): BACE-EGFP kotransfiziert mit GGA2-mRFP (n=22), Median 1660 ps (1580 ps/1749 ps)
3 (blau): BACE(LL499/500AA)-EGFP kotransfiziert mit GGA2-mRFP (n=12) hat einen Median von
1802 ps (1766 ps/1921 ps).
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Abb. 29 zeigt Momentaufnahmen von Zellen, die die beschriebenen Daten
veranschaulichen
und
die
Lokalisation
von
BACE(LL499/500AA) und deren Kombinationen zeigen.
GGA2,
BACE
und
3 Ergebnisse
72
1a
1b
1c
2a
2b
2c
Lifetime: 1400ps
2200ps
Abb. 29: Repräsentative Zellen: GGA2 und BACE (Wildtyp und als LL499/500AA- Variation)
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: BACE-EGFP
1b: BACE-EGFP mit GGA2-mRFP
1c: BACE(LL499/500AA)-EGFP mit GGA2-mRFP
Reihe 2: Farbkodierte Bilder, in denen die gemessene Lifetime in Pikosekunden (ps) anhand
einer Farbskala von 1400 ps (orange) bis 2200 ps (blau) kodiert wurde
2a: BACE-EGFP zeigt ohne Transfektionspartner eine Lifetime von circa 2000 ps
2b: GGA2-mRFP mit BACE-EGFP, das Wildtype BACE-Protein, zeigt bei der Kotransfektion
mit GGA2 in der Farbcodierung eine Abnahme der Lifetime auf circa 1600 ps
2c: GGA2-mRFP mit BACE(LL499/500AA)-EGFP, die BACE-Variante mit mutierter
Bindungsstelle zeigt bei der Kotransfektion mit GGA2-mRFP eine Lifetime im blauen
Farbbereich von circa 2000 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
3 Ergebnisse
73
Die Transfektion von BACE-EGFP alleine ergibt in der abgebildeten Zelle
zunächst neben der weiterhin konstanten Verteilung des Proteins eine Lifetime in
der Farbkodierung von circa 2000 ps (1a und 2a, Abb.29). Die mutierte BACEVariante zeigt bei ihrer Transfektion zusammen mit GGA2 auch Lifetime-Werte,
die nahe an der Baseline-Lifetime von 2000 ps liegen (1c und 2c, Abb.29).
Außerdem zeigen sich vereinzelte intra- und extrazelluläre Farbkodierungen, die
auf eine reduzierte Lifetime in diesen Bereichen schließen lassen. Die
gemeinsame Transfektion von GGA2 mit der Wildtyp BACE-Variante lässt eine
deutliche Verringerung der Lifetime erkennen, wobei sich die Verteilung in der
Zelle nicht verändert (1b und 2b, Abb.29).
GGA3 und BACE oder BACE(LL499/500AA)
Als letzter Teil dieser Versuchsreihe wurden die beiden verschiedenen BACEVarianten bezüglich ihres Verhaltens mit GGA3-mRFP untersucht (Abb.30).
Die Kotransfektion von GGA3-mRFP mit BACE-EGFP (rot) zeigt sowohl
gegenüber BACE-EGFP allein (grün), als auch im Vergleich zu der gemeinsamen
Transfektion von BACE(LL499/500AA)-EGFP mit GGA3-mRFP (blau) eine höchst
signifikante Abnahme der Lifetime auf einen medianen Wert von 1672 ps (1571
ps/1859 ps). Die Lifetime von BACE-EGFP entspricht denen der
vorangegangenen Experimente und liegt weiter bei einem Median von 1916 ps
(1856 ps/1938 ps). Die Werte der mutierten BACE-Variante in Kombination mit
GGA3-mRFP liegen um 1896 ps (1835 ps/1960 ps) und zeigen somit keinerlei
signifikante Abweichung von der Baseline-Lifetime.
Lifetime (ps)
3 Ergebnisse
74
2400
***
***
2200
2000
1800
1600
1400
1200
1000
1
2
3
Transfektionsansätze
Abb. 30: Statistik: GGA3 und BACE (Wildtyp und als LL499/500AA- Variation)
Box-Plot: Die Box markiert den Bereich zwischen der 25ten und der 75ten Percentile (die Werte werden im
Folgenden in Klammern hinter dem Median, der als durchgehende Linie dargestellt ist, angegeben) und die
Antennen die 5te beziehungsweise 95te Percentile. Es wurde ein orientierender unverbundener Test
durchgeführt (Mann-Whitney Rangsummentest) und die Signifikanz der Abweichungen der Lifetimes zwischen
Kontrolle und Experiment anhand der p-Werte mit Sternchen gekennzeichnet(*: p<0,05,signifikant,
**:p<0,01,sehr signifikant, ***:p<0,001,höchst signifikant). Die n-Werte beziehen sich auf die Anzahl der
ausgewerteten Zellen.
1 (grün): Einzeltransfektion von BACE-EGFP (n=37) zeigt einen Median von 1916 ps
(1856 ps/1938 ps)
2 (rot): BACE-EGFP kotransfiziert mit GGA3-mRFP (n=21) hat einen Median von
1672 ps (1571 ps/1859 ps).
3 (blau): BACE(LL499/500AA)-EGFP kotransfiziert mit GGA3 (n=20) hat einen Median von
1896 ps (1835 ps/1960 ps).
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Die folgenden repräsentativen Bilder einzelner Zellen zeigen die Verteilung der
Proteine in vivo und geben Aufschluss darüber, ob und wo in der Zelle eine
Reduktion der Lifetime stattfindet (Abb.31).
3 Ergebnisse
75
1a
1b
1c
2a
2b
2c
Lifetime:
1400ps
2200ps
Abb. 31: Repräsentative Zellen: GGA3 und BACE (Wildtyp und als LL499/500AA- Variation)
Reihe 1: Die schwarzweißen Bilder stellen die “Intensity Images“ dar, sie zeigen die Verteilung der
Fluorophor markierten Proteine in der Zelle
1a: BACE-EGFP
1b: BACE-EGFP mit GGA3-mRFP
1c: BACE(LL499/500AA)-EGFP mit GGA3-mRFP
Reihe 2: Farbkodierte Bilder, in denen die gemessene Lifetime in Pikosekunden (ps) anhand
einer Farbskala von 1400 ps (orange) bis 2200 ps (blau) kodiert wurde
2a: BACE-EGFP zeigt ohne Transfektionspartner eine Lifetime von circa 2000 ps
2b: BACE-EGFP mit GGA3-mRFP, das Wildtype BACE-Protein, zeigt bei der Kotransfektion
mit GGA3 eine Abnahme der Lifetime auf circa 1600 ps
2c: BACE(LL499/500AA)-EGFP mit GGA3-mRFP, die BACE-Variante mit mutierter
Bindungsstelle zeigt bei der Kotransfektion mit GGA3-mRFP eine Lifetime von circa
1900 ps
Abkürzungen: GGA: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factor-binding protein, BACE: βAmyloid- Cleaving Enzym, VHS: Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor Substrate,- Signal
Transducing Adaptor Molecule, EGFP: Enhanced Green Fluorescent Protein, mRFP: modifiziertes Red Fluorescent Protein,
ps: Picosekunde
Die Einzeltransfektion von BACE-EGFP mit korrektem DXXLL-Aminosäuremotiv
(DISLL) zeigt, wie bereits in den anderen Experimenten, in dieser repräsentativen
3 Ergebnisse
76
Zelle, eine perinukleäre Verteilung und eine Lifetime um die 2000 ps (1a und 2a,
Abb.31). Bei der Transfektion von BACE(LL499/500AA)-EGFP mit GGA3-mRFP
kann in dieser Abbildung eine leichte Abnahme der Lifetime auf circa 1900 ps
beobachtet werden, während die Verteilung in der Zelle unverändert blieb (1b und
2b, Abb.31). Eine wesentlich deutlichere Reduktion der Lifetime kann bei der
Transfektion von BACE-EGFP mit GGA3-mRFP gezeigt werden. Hier sinken die
Werte der Lifetime in der Farbcodierung auf circa 1600 ps, wobei sich die
Proteinverteilung nicht wesentlich verändert (1c und 2c, Abb.31).
Auch bei GGA3 zeigt sich bei Koexpression mit BACE eine Abnahme der EGFPLifetime, die bei Koexpression mit BACE(LL499/500AA) nicht in diesem Ausmaß
beobachtet werden kann.
BACE-EGFP zeigt bei Kotransfektion mit GGA1-mRFP, GGA2-mRFP und
GGA3-mRFP eine deutliche Abnahme der Baseline-Lifetime. Bei mutiertem
DXXLL-Bindungsmotiv tritt diese Reduktion nicht auf, obwohl beide Proteine in
räumlicher Nähe zueinander liegen.
4 Diskussion
77
4 Diskussion
4.1 Material und Methoden
4.1.1 Zellmodell
Die in dieser Arbeit verwendeten Zellinien bieten sich als Modell an, um
intrazelluläre Prozesse in Neuronen zu untersuchen. Die N2A-Zellen stammen aus
einem Neuroblastom der Maus. Durch ihre Eigenschaften als Tumorzellen kann
ein schnelles Wachstum und ein langes Überleben der Zellen beobachtet werden,
was sich in der Laborarbeit als sehr vorteilhaft herausgestellt hat. Durch das
sogenannte Splitten der Zellen kann eine Konstanthaltung der Bedingungen nach
jedem Passagieren gewährleistet werden. Allerdings finden sich auch Fibroblasten
und Mikroglia in der Zellsuspension der N2A-Zellen, was zu einem ihrer Nachteile
gezählt wird, da der Einfluss dieser Zellen auf die N2A-Neuroblastomzellen nicht
abgeschätzt werden kann. Desweiteren besteht eine gewisse Unsicherheit im
Bezug auf die möglichen Mutationen im Genom der Neuroblastomzellen. Ob diese
Zellen in ihrer Funktionalität den physiologischen Bedingungen in einem
menschlichen Gehirn nahe kommen, kann nicht sicher gesagt werden. Die N2AZellen bieten trotz einiger Nachteile ein gutes Modell für die Untersuchung
intrazellulärer Prozesse.
Die U373-Zellen haben den großen Vorteil, dass sie aus einem humanen
Glioblastom stammen. Dadurch wird zumindest im Hinblick auf die Spezies ein
Schritt in Richtung der Vergleichbarkeit unternommen. Allerdings besteht der
Nachteil, dass Gliazellen sich in ihrer Funktion (Stabilisierung und Versorgung der
Neurone) von denen der Neurone unterscheiden. Die U373-Zellen haben sich bei
den Transfektionen durch geringere Apoptoseraten als die N2A-Zellen und durch
eine bessere Handhabung ausgezeichnet.
In Abwesenheit von ethisch durchführbaren AlterWildtypen bieten sowohl die N2AZellen, als auch die U373-Zellinie ein adäquates Modell zur Erforschung
intrazellulärer Prozesse in lebenden Zellen.
4 Diskussion
78
4.1.2 Transfektion
Eine Transfektion mit Plasmid-DNA bringt eine Zelle dazu, mehr von einem
Protein zu produzieren als physiologisch notwendig. Dadurch können die Proteine
besser untersucht werden, da die physiologischen Mengen häufig für eine
Detektion nicht ausreichen. In dieser Arbeit wurden BACE und GGAs mit
Fluorophoren verbunden, um sie nachweisen zu können. Ob die Überexpression
der Proteine und der angehängten Fluorophore die zelluläre Homöostase
beeinflusst, kann nicht ausgeschlossen werden. Besonders in den N2A Zellen
konnte eine vermehrte Induktion von morphologischen Veränderungen unter dem
Mikroskop beobachtet werden, die durchaus als apoptotischen Ereignisse
interpretiert werden konnten. Nach einer Expressionszeit von über 24 Stunden
kam es regelmäßig zur vermehrten Bildung von großen Vesikeln, wahrscheinlich
Lysosomen, die mit den transfizierten Proteinen beladen waren. Um diese
unphysiologischen Ereignisse zu vermeiden, wurden die Experimente zu einem
Zeitpunkt durchgeführt, an dem sich optisch noch keine morphologischen
Veränderungen der Zellen nachweisen ließen. Bei den N2A-Zellen entsprach dies
einem Zeitraum von 12 Stunden, bei den U373-Zellen einem Zeitraum von 24
Stunden nach der Transfektion.
4.1.3 Konfokale Laserscanning Mikroskopie
Im Gegensatz zur herkömmlichen Fluoreszenzmikroskopie kann mit dieser
Methode mit Hilfe des 510 META-Mikroskops und dem Einsatz spezieller Filter
das mRFP separat vom EGFP angeregt und auch detektiert werden. Dadurch wird
verhindert, dass es zu einer gleichzeitigen Anregung der Fluorophore kommt. Dies
würde zu einem falsch positiven Ergebnis bei dem computergestützen
Übereinanderlegen der Bilder führen. In dieser Arbeitwurde sichergestellt, dass
der rote Kanal tatsächlich nur die Emission des spezifisch angeregten mRFP, und
der grüne Kanal die Emission des spezifisch angeregten EGFP enthielt. So
entspricht das übereinandergelegte Bild tatsächlich einer Kolokalisation der beiden
Proteine. Aufgrund der Möglichkeit, das Pinhole und damit die aufgenommene
Schichtdicke zu verändern, kann eine beliebige Schicht der Zelle untersucht
werden. In herkömmlichen Methoden der Fluoreszenzmikroskopie repräsentierten
die Bilder immer eine Aufnahme der gesamten Zelle. Wird dort eine Kolokalisation
4 Diskussion
sichtbar,
kann
ausgeschlossen
79
diese
genauso
werden
gut
konnte,
zufällig
dass
die
entstanden
betroffenen
sein,
da
Proteine
nicht
sich
in
unterschiedlicher Höhe in der Zelle befinden. Durch eine möglichst geringe
Schichtdicke bei der Einstellung des Pinholes kann bei der konfokalen
Mikroskopie sichergestellt werden, dass die Proteine sich tatsächlich in
unmittelbarer Nähe zueinander befinden. Durch ein sehr kleines Pinhole wird
allerdings die Intensität der Emissionen so eingeschränkt, dass ein Kompromiss
zwischen Schichtdicke und Emissionsintensität gefunden werden muss.
Obwohl die Konfokale Laser Mikroskopie viele Vorteile bietet, unter anderem die
variable Schichtdicke, ist sie dennoch nicht frei von potentiellen Fehlerquellen.
Sämtliche Proteine, die in einer Zelle überexprimiert werden, werden zu
irgendeinem Zeitpunkt im Golgi-Apparat modifiziert. GGA-Proteine und BACE
haben einen ihrer Lokalisationsschwerpunkte genau in diesem Zellkompartiment.
Deshalb ist es schwer zu entscheiden, ob eine Kolokalisation stattfindet, weil
beide Proteine zeitgleich im Golgi-Apparat modifiziert werden, oder ob sie am Ort
ihrer zellulären Bestimmung angekommen sind und ihren physiologischen
Aufgaben
nachkommen.
Zur
Lösung
dieser
Problematik
muss
davon
ausgegangen werden, dass sich nach einer gewissen Zeit der Überexpression die
Verteilung der Proteine in der Zelle dem natürlichen Gleichgewicht angepasst hat
und dabei zwar eine höhere Konzentration der Proteine vorliegt, diese sich aber
anhand der physiologischen Vorgaben verteilt haben. Ein ähnliches Problem tritt
bei Betrachtung von GGAs und BACE in Endosomen und Lysosomen auf. Ein
überexprimiertes Protein wird früher oder später von der Zelle als funktionell
nutzlos erkannt und abgebaut. Dieser Transportweg kann über Endosomen und
Lysosomen stattfinden. Deshalb ist auch hier davon auszugehen, dass GGAs und
BACE in überexprimierter Form nach einiger Zeit der Expression auch als
Abbauprodukte nebeneinander existieren, aber ihr Vorkommen hauptsächlich ihrer
natürlichen Verteilung in der Zelle entspricht.
Die Lokalisationen von GGAs im TGN, im Golgi-Apparat, und in perinukleären
Kompartimenten (Dell'Angelica et al. 2000; Hirst et al. 2000; Doray et al. 2002;
Doray et al. 2002) und BACE im Golgi-Apparat, Endosomen, Lysosomen und an
der Zelloberfläche in Lipideinschnürungen (Huse et al. 2000; Riddell et al. 2001;
Chyung und Selkoe 2003; Kinoshita et al. 2003) wurden bereits häufig in der
Literatur beschrieben, so dass in dieser Arbeit auf die Identifizierung von
4 Diskussion
80
Zellkompartimenten mit entsprechenden Antikörpern verzichtet wurde. Durch die
Konfokale Mikroskopie konnte so die Lokalisation gut abgeschätzt werden und
eine Kolokalisation der GGAs und BACE gezeigt werden. Auf den genauen
Lokalisationsnachweis wurde zugunsten der folgenden Experimente verzichtet, in
denen die potentielle Interaktion der Proteine im Mittelpunkt stand.
4.1.4 FRET/FLIM/SLIM
Zum Nachweis einer Interaktion zwischen zwei Proteinen stehen verschiedene
Methoden zur Verfügung. Eine der häufig verwendeten Nachweismethoden ist die
Co-Immunopräzipitation und Pull-down-Essays. Diese Methode wurde im
Zusammenhang mit den GGA-Proteinen und BACE bereits angewandt, es
konnten bisher allerdings nur isolierte VHS-Domänen erfolgreich verwendet
werden (He et al. 2002; Wahle et al. 2005). Die Problematik besteht vermutlich in
einer Konformationsänderung, die eine Bindung an die zur Extraktion benötigten
Aufreinigungsmatrix verhindert. Bei dem Versuch der Co-Immunopräzipitation
treten ähnliche Probleme auf, da es bisher keine Veröffentlichung mit dieser
Methode unter Verwendung vollständiger GGA-Proteine gibt.
Diese Problematik machte die Suche nach einer alterWildtypen, besser
geeigneten Nachweismethode notwendig. Die FRET/FLIM-Methode, in der die
Energieübertragung zwischen zwei Fluorophoren und damit die unmittelbare Nähe
zweier Proteine, durch eine Abnahme der Donor-Lifetime sichtbar gemacht wird,
bietet zusätzlich weitere Vorteile, die im Folgenden kurz beschrieben werden
sollen.
Es ist möglich, die Abläufe in einer Zelle zu beobachten, ohne deren Integrität
zerstören zu müssen. Außerdem bietet diese Methode die Möglichkeit, zusätzlich
zu Informationen über die potentielle Interaktion auch Hinweise auf die
Lokalisation zu geben, an welcher diese Aktivitäten stattfinden. Die Methode ist
ferner unabhängig von der Konzentration der Fluoreszenzproteine. Im Gegensatz
zur FRET/FLIM-Methode kann beim SLIM durch die spektrale Auflösung
zusätzlich die Anwesenheit des Akzeptors nachgewiesen werden (Ruck et al.
2007). Sie bietet dadurch eine essentielle Information zur Interpretation der
Ergebnisse. Die Etablierung dieser Methode zum Nachweis einer unmittelbaren
Nähe zweier Proteine in lebenden Zellen ist zeitaufwändig und kompliziert. Es
4 Diskussion
81
konnte aber erreicht werden, dass unter Verwendung dieser Methode nun
reproduzierbare und vergleichbare Experimente mit beliebigen Zellproteinen
durchgeführt werden können.
EGFP/mRFP
EGFP und mRFP wurden noch nicht häufig als FRET-Paar benutzt, da die
meisten FRET-Experimente in fixierten Zellen unter der Zuhilfenahme von mit
Fluoreszenzfarbstoff markierten Antikörpern durchgeführt wurden. In dieser Arbeit
wurde durch einen EGFP-mRFP-Tandem, der sicherstellt, dass der Abstand von
EGFP zu mRFP im Förster-Radius von weniger als 10 nm liegt, zunächst
nachgewiesen, dass die beiden Fluoreszenzproteine tatsächlich ein ausgeprägtes
FRET-Phänomen auslösen können. Da dies sowohl in den Kontrollversuchen, als
auch in den Experimenten der Fall war, lässt sich schlussfolgern, dass EGFP und
mRFP als FRET-Paar gut geeignet sind und sich für viele Experimente in
lebenden Zellen eignen.
Bei den Experimenten mit der SLIM-Methode wurde eine Abnahme der Lifetime
des Donors (EGFP) festgestellt und so eine Interaktion von BACE mit den GGAs
nahegelegt. Das Phänomen des FRET ist von vielen Komponenten abhängig. Die
Lifetime eines Fluorophores verändert sich wenn es an ein Protein gekoppelt wird.
Deswegen wurde bei sämtlichen Messungen das mit EGFP verbundene Protein
als Negativkontrolle zur Bestimmung der Baseline-Lifetime verwendet.
Einflüsse auf den Energietransfer
Auch andere Faktoren können die Lifetime des Donors verändern. Die
Aggregation von gleichen Fluorophoren kann zum sogenannten Homo-FRET
führen. Hierbei wird die Energie gegenseitig zwischen den EGFPs übertragen, so
dass es bei einigen zu einer Abnahme der Lifetime kommt. Dies äußert sich in den
Messungen durch extrem kurze Lifetimes (Luchowski et al. 2008). Durch eine
selektive Betrachtung der realistischen Lifetime-Abnahmen konnte dieses
Phänomen erkannt und aus der Auswertung ausgeschlossen werden. In den
Experimenten mit einer Kotransfektion zweier Proteine wurde dem Homo-FRET
Rechnung getragen, indem
eine entsprechende Menge der potentiellen
Interaktionspartner verwendet wurde. So konnte der Energietransfer zwischen
4 Diskussion
82
zwei verschiedenen Proteinen gewährleistet werden. Da das Homo-FRET
ubiquitär in allen SLIM Experimenten vorkam, kann davon ausgegangen werden,
dass die Abnahme der Lifetime an sich nicht signifikant davon beeinflusst wurde,
da sowohl Negativkontrollen als auch Experimente im gleichen Maße davon
betroffen waren.
Auch eine Autofluoreszenz der Zellen wird als störendes Ereignis im Bezug auf
das FRET beschrieben (Li et al. 1999). Dabei muss gesagt werden, dass diese
Beobachtungen sich vor allem auf die Autofluoreszenz von Geweben beziehen
und deshalb in dieser Arbeit keine Beeinträchtigung darstellt. Außerdem wären
auch hier alle Zellen gleich betroffen und somit der Effekt auf die Messungen
vernachlässigbar. Denn sowohl die eigentlichen Experimente, als auch die
Negativkontrollen basieren auf dem gleichen Zellmodell.
Ein anderes Problem stellt die Beeinflussung des FRET durch den pH-Wert dar.
Ein niedriger pH und damit eine erhöhte Menge an Protonen führt zu einer
Abnahme der Lifetime (Lakowicz et al. 1992). Allerdings befinden sich die
untersuchten Proteine in den selben Zellkompartimenten und unterliegen so auch
dem selben pH-Wert.
Viele Faktoren können die Lifetime eines Donor-Fluorophores beeinflussen. Das
FRET unterliegt vielfältigen Einflüssen, die aus Wechselwirkungen im Zellmilieu
entstehen. Eine große Herausforderung war deshalb, bei jeder Messung ein
möglichst gleiches Zellmilieu zu schaffen. Dies wurde erreicht, indem die Zellen
nach einem genau etablierten Protokoll transfiziert wurden und unter denselben
Bedingungen der Messung zugeführt wurden. Dennoch konnten durch das
Zellmilieu bedingte Schwankungen zwischen den einzelnen Messtagen nicht ganz
verhindert werden. Um technisch bedingte Schwankungen der Messergebnisse
zwischen den einzelnen Tagen zu minimieren, wurde der verwendete Laser an
jedem Messtag kalibriert, da vor allem Temperaturschwankungen in den
Räumlichkeiten einen Einfluss auf die Lasereinstellungen haben. Trotz aller
Gegenmaßnahmen
können
Abweichungen
der
Messergebnisse
nicht
ausgeschlossen werden. Diese stellen sich allerdings durch gleichgerichtete
veränderte Werte zwischen den Negativkontrollen und den Experimenten dar, so
4 Diskussion
83
dass die Tendenz und die absoluten Werte der Lifetime Reduktion durch alle
Messungen hinweg identisch blieb und immer wieder bestätigt werden konnte.
Auswertungsmethoden
Die Auswertung der Rohdaten der Lifetime- Messung mit SPCImage bietet viele
Möglichkeiten. Allerdings existiert kein allgemeingültiges Protokoll für dieses
Programm, da die Messungen und die Zielsetzungen der verschiedenen
Forschungsgruppen stark voneinander abweichen. Aus diesem Grund unterliegt
die Auswertung immer einer gewissen subjektiven Komponente, die durch ein
streng reglementierendes Protokoll aber kontrolliert werden kann. Für diese Arbeit
wurde in Anlehnung an die Protokolle von Thomas et al. 2008 und Ruck et al.
2007
ein
individuelles
Protokoll
etabliert,
dass
den
Bedingungen
und
Zielsetzungen der Experimente angepasst war. Durch konsequente Einhaltung
dieses Protokolls konnten in den Auswertungen der Kontrollen und Experimente
konstante Werte erreicht werden.
4.2 Ergebnisse
Sowohl die Aβ-Plaques, fibrilläre Tau-Ablagerungen, oxidativer Stress und
Entzündungsvorgänge im Gehirn der Patienten sind plausible pathologische
Ursachen
der
Alzheimer
Erkrankung.
Vor
allem
ein
multifaktorielles
Zusammenspiel aller Ursachen liegt nahe. Die einzelnen Phänomene scheinen
sich gegenseitig zu beeinflussen und wechselzuwirken. Dabei können vor allem
wichtige Signalkaskaden und Transportproteine eine Rolle spielen. Deshalb wurde
in dieser Arbeit der Fokus auf die wichtigen Transportproteine GGA gelegt, die
vielleicht nicht nur bei der Bildung von Aβ-Plaques, sondern auch bei den anderen
diskutierten molekularen Ursachen der Alzheimer Erkrankung eine Rolle spielen
können.
4.2.1 Lokalisation
In der Konfokalen Lasermikroskopie stellte sich die zelluläre Verteilung von BACE
optisch folgendermaßen dar. BACE akkumuliert vor allem im Bereich um den
Nukleus, lässt sich aber auch in Vesikeln in der Zellperipherie darstellen. Diese
4 Diskussion
84
Arbeit konnte zeigen, dass die Lokalisation von BACE in lebenden Zellen den
bisher postulierten Aussagen hinsichtlich der zellulären Lokalisation von BACE im
Golgi-Apparat,
Endosomen,
Lysosomen
und
an
der
Zelloberfläche
in
Lipideinschnürungen (Huse et al. 2000; Riddell et al. 2001; Chyung und Selkoe
2003; Kinoshita et al. 2003) entspricht. Bei Betrachtung der mutierten BACEVariante konnte beobachtet werden, dass sie vermehrt in der Peripherie des
Zytoplasmas und auch teilweise an der Zellmembran verteilt zu sein schien. Dies
deutet darauf hin, dass das DXXLL-Motiv für die Lokalisation von BACE in der
Zelle eine entscheidende Rolle spielt. Auch über die Lokalisation von GGA1,
GGA2 und GGA3 konnte ein Überblick mit dieser Methode geschaffen werden,
und die Verteilung dieser Proteine im TGN, im Golgi-Apparat, und in perinukleären
Kompartimenten (Dell'Angelica et al. 2000; Hirst et al. 2000; Doray et al. 2002;
Doray et al. 2002) optisch verdeutlicht werden.
Des Weiteren konnte in der Konfokalen Lasermikroskopie eine Kolokalisation von
GGA1, GGA2 und GGA3 gezeigt werden, welches die Ergebnisse der derzeitigen
Forschung unterstützt und sogar verstärkt, da der Nachweis hier im lebenden
Zellmodell durchgeführt wurde. Alle drei GGA-Proteine kommen an denselben
Orten in der Zelle vor und können somit alle wichtigen Transportfunktionen
ausführen. Die GGA-Varianten mit deletierter VHS-Domäne zeigten in der
Konfokalen Lasermikroskopie eine leicht veränderte Lokalisation gegenüber den
Wildtyp Proteinen. Ihre Verteilung war zwar auch vor allem um den Nukleus
fokussiert, ihre Verteilung mutete aber insgesamt etwas feiner und mehr
zytoplasmatisch an. Dieser Beobachtungen erscheinen plausibel, da den ∆VHSGGAs eine wichtige Domäne fehlt, die ihre physiologische Verteilung begünstigen
würde. Dennoch zeigte diese Momentanaufnahme einer lebenden Zelle in der
Konfokalen Lasermikroskopie, dass sowohl die mutierten, als auch die Wildtypen
Varianten von BACE und GGAs optisch hauptsächlich in Zellkompartimenten
vorhanden sind, die mit anderen Methoden auch beschrieben werden.
4.2.2 Interaktion von BACE mit den GGAs
Es wird eine deutliche und signifikante Abnahme der Lifetimes bei der
gemeinsamen Transfektion von den GGAs mit BACE demonstriert, was eine
Interaktion der beiden Proteine nahelegt. Es wird außerdem dargestellt, wie sich
4 Diskussion
85
die ∆VHS-GGAs bei einer Transfektion mit BACE verhalten. Obwohl die Proteine
noch immer nahe in den perinukleären Kompartimenten zusammenliegen, kommt
es aufgrund der fehlenden VHS-Bindungsdomäne der GGAs zu keiner Interaktion.
Die Lifetimes dieser Kotransfektionen unterscheidet sich nicht wesentlich von den
reinen Einzeltransfektionen mit den GGA-EGFP-Varianten.
Durch die Elimination der VHS-Domäne der GGA-Proteine konnte gezeigt werden,
dass ohne sie eine Verringerung der Donor-Lifetime im FRET/FLIM-Experiment
nicht möglich war. Daraus kann geschlossen werden, dass ohne diese Domäne
eine Bindung und eine Interaktion zwischen BACE und den GGAs als extrem
unwahrscheinlich angesehen werden kann. Gleichzeitig dient dieses Ergebnis als
interne Kontrolle, um eine zufällige Energieübertragung aufgrund der räumlichen
Nähe auszuschließen.
Auch die Mutation des DXXLL Motivs von BACE führte zu einer verminderten
Abnahme der Donor-Lifetime. Dies bestätigt die Aussage von He et al., dass für
eine Bindung zwischen BACE und den GGA-Proteinen sowohl die VHS-Domäne,
als auch das DXXLL-Motiv von entscheidender Bedeutung ist. He et al. zeigten
2002, dass BACE-Proteine mit ihrem DXXLL-Motiv an die isolierten VHSDomänen aller drei bekannten GGA-Proteine binden. Dieses Experiment konnte
allerdings nicht mit den kompletten GGA-Proteinen durchgeführt werden, da es
vermutlich zu einer Konformationsänderung kam und die VHS-Domäne für eine
Bindung an DXXLL nicht mehr erreichbar war. In dieser Arbeit konnten beide
Bindungsdomänen in lebenden Zellen untersucht werden
Es wurde bereits gezeigt, dass mithilfe der FRET/FLIM-Methode eine Interaktion
von BACE mit GGA1 als wahrscheinlich anzusehen ist (von Arnim et al. 2004).
Allerdings wurde dieser Nachweis in fixierten Zellen und mit Fluoreszenzfarbstoff
markierten Antikörpern durchgeführt. In dieser Arbeit konnte darüber hinaus
gezeigt werden, dass die gleichen Phänomene sich auch im lebenden Zellmodell
nachweisen lassen. Zusätzlich konnten auch GGA2 und GGA3 in die
Beobachtungen mit einbezogen werden und auch sie zeigten nicht nur eine starke
räumliche Nähe zu BACE, sondern auch Hinweise auf eine Interaktion, was sich in
einer herabgesetzten Donor-Lifetime äußerte.
GGA1, GGA2 und GGA3 unterscheiden sich in ihrem Aufbau (Abb.5) und in
einigen ihrer Struktureigenschaften.
4 Diskussion
86
GGA1, hat vier identifizierte potentielle Phosphorylierungsstellen in der GATDomäne und Hinge-Region. Die Aktivierung beziehungsweise Inaktivierung dieser
Phosphorylierungsstellen kann jeweils zu einer engeren Bindung an die
Membranen des TGN führen, oder eine Umverteilung von GGA1 in periphere
Regionen des Zytoplasmas induzieren (McKay und Kahn 2004). GGA1 ist das
Einzige der drei GGA-Proteine, dass einen Einfluss auf den Transportweg von
Adiponectin durch die Zelle hat (Xie et al. 2006).
GGA2 unterscheidet sich durch eine offene Konformation in der VHS-Domäne von
den beiden anderen Proteinen, die eine α-helikale Struktur vorweisen. Diese
Konformation in GGA2, die flexibel ist, könnte dazu beitragen, dass sich die
Domäne an verschiedene zu transportierende Substrate anpassen kann. (Zhang
et al. 2007).
GGA3 hat fünf identifizierte potentielle Phosphorylierungsstellen, die nur teilweise
homolog zu den entsprechenden Stellen im GGA1-Protein sind (McKay und Kahn
2004). EGF führt zu einer Phosphorylierung in der Hinge Region von GGA3 und
zu einer Konformationsänderung des Proteins, was zu herabgesetzten Assoziation
mit Membranen führt (Kametaka et al. 2005).
Des Weiteren wurden unterschiedliche Bindungskonstanten (Kd) der VHS
Domänen der drei GGA Proteine mit BACE festgestellt. Eine Phosphorylierung
von BACE führt zu einer Abnahme der Kd der VHS Domäne um das Zehnfache bei
GGA1, das Vierfache bei GGA2 und das Vierzehnfache bei GGA3 führte. Diese
Beobachtung lässt vermuten, dass die drei Proteine ein unterschiedlich starkes
Bindungsvermögen ihrer VHS Domäne gegenüber BACE zeigen (He et al. 2003).
In dieser Arbeit konnte allerdings gezeigt werden, dass sich die drei GGAs trotz all
ihrer Unterschiede in der Struktur und ihrer Phosphorylierungsstellen gleich
verhalten. Sowohl was ihre Lokalisation in der Zelle betrifft, als auch ihr Verhalten
bei Kotransfektion mit BACE. Der Unterschied in den Bindungskonstanten von He
et al. ist dennoch höchst interessant. Zusammen mit den Ergebnissen dieser
Arbeit kann postuliert werden, dass GGA1, GGA2 und GGA3 alle in den
Transportweg von BACE involviert sind, aber wahrscheinlich unterschiedlich
gewichtete Rollen inhaben.
4 Diskussion
87
4.2.3 Interaktionen/Transportwege
In dieser Arbeit konnte gezeigt werden, dass sowohl GGA1, als auch GGA2 und
GGA3 einen sehr engen räumlichen Bezug (kleiner 10 nm) zu BACE haben.
GGA1 scheint sowohl den Transport vom TGN zu den Endosomen als auch den
entsprechenden retrograden Transport von den Endosomen zurück zum TGN zu
regulieren (Wahle et al. 2005) und hat somit vermutlich auch einen Einfluss auf die
Prozessierung von APP durch BACE.
Da hier gezeigt werden konnte, dass GGA2 und GGA3, sich in ihrer Nähe und
damit vermutlicher Interaktion zu BACE genauso darstellen wie GGA1, liegt die
Aussage nahe, dass auch sie in den Transport von BACE involviert sind.
Tesco et al. zeigten in Gehirnproben von Alzheimerpatienten im Temporallappen
neben einer erhöhten Konzentration von Aβ eine gleichzeitige Erhöhung von
BACE. Diese vermehrte BACE-Konzentration korrelierte umgekehrt proportional
zu einem erniedrigten GGA3-Level (Tesco et al. 2007). Allerdings wurde bisher
noch kein experimenteller, signifikanter Einfluss von GGA1, GGA2 und GGA3 auf
die Prozessierung von APP festgestellt (Walter et al. 2001; Pastorino et al. 2002).
Dies legt nahe, dass noch andere Transportproteine und Faktoren einen Einfluss
auf die APP-Prozessierung haben, und nicht nur das verminderte Vorkommen von
BACE in der Nähe von APP der ausschlaggebende Faktor für eine herabgesetzte
Prozessierung ist. Es müssen nun, da eine Interaktion und ein Einfluss auf den
BACE-Transport als sehr wahrscheinlich gilt, sowohl für GGA1 als auch für GGA2
und GGA3 mehr funktionelle Untersuchungen hinsichtlich der APP-Prozessierung
durchgeführt werden.
Die GGA-Proteine haben eine ganze Reihe von Interaktionspartnern und
Faktoren, die ihre Phosphorylierung und somit ihre Aktivität beeinflussen.
Adenosindiphosphat (ADP)-Ribosylations Faktoren (ARFs), Clathrin, Adaptor
Protein 1 und Rabaptin-5, um nur einige zu nennen (Hirst et al. 2000; Bonifacino
2004). Dies könnte das Fehlen einer einfachen Erklärung für den Transport von
BACE und somit der Prozessierung von APP erklären.
Aber auch BACE hat noch andere potentielle Interaktionspartner. Das Low density
Lipoprotein Rezeptor-Related Protein (LRP) zum Beispiel, welches sogar von
BACE in Lipideinschnürungen an der Zelloberfläche prozessiert wird (von Arnim et
al. 2005). Es ist also augenscheinlich, dass nicht nur die amyloidogene
4 Diskussion
88
Prozessierung von APP in der Alzheimer Erkrankung, sondern auch andere,
vermutlich physiologische Aktivitäten des Enzyms bei seinem Transport eine Rolle
spielen und diese von anderen Faktoren reguliert werden.
Sogar APP interagiert nicht ausschließlich mit BACE. Zunächst sind natürlich auch
die α-Sekretase und die γ-Sekretase an seiner Prozessierung beteiligt. Aber auch
andere Proteine wie LRPI B, SorLA/LRII und Apolipoprotein Rezeptor 2 und das
bereits erwähnte LRP scheinen einen Einfluss auf den Transport von APP und
somit seine Prozessierung zu haben (Cam und Bu 2006; Spoelgen et al. 2006).
Wenn man all diese verschiedenen Proteine betrachtet, die mit den wohl
wichtigsten Proteinen in der Entstehung der Alzheimer Erkrankung (APP und
BACE) und den GGAs interagieren oder Einfluss auf sie nehmen, ist erkennbar,
wie komplex die Transportwege und Auswirkungen auf die APP Prozessierung
sind.
4.3 Ausblicke in der Forschung
Die Grundlagenforschung in der Alzheimerforschung ist sehr aktiv, aber dennoch
bleiben noch viele Fragen ungeklärt.
Aufgrund der vielversprechenden Ergebnisse dieser Arbeit liegt es zunächst nahe,
die Experimente in primären Neuronen (aus ethischen Gründen können
momentan nur primäre Neurone aus Ratten oder Mäusen verwendet werden) zu
wiederholen. Dies bietet den Vorteil, dass die Zellen keine Tumoreigenschaften
und auch weniger Mutationen im Genom aufweisen.
Außerdem müssen die Interaktionspartner von APP, BACE und den GGAs
vollständig identifiziert werden. Es ist wahrscheinlich, dass es in dieser Hinsicht
Gemeinsamkeiten gibt wie LRP, das sowohl an APP bindet, als auch von BACE
prozessiert wird. Ferner muss die physiologische Funktion von APP geklärt
werden, auch um zu verstehen, warum bei der Alzheimer Erkrankung der
amyloidogene Prozessierungsweg eingeschlagen wird.
Im Zusammenhang mit dieser Arbeit liegt der weitere Fokus der Forschung auf der
Entwicklung von funktionellen Experimenten, die einen Nachweis darüber bringen
sollen, ob eine herabgesetzte GGA-Exprimierung zu einer Veränderung der
4 Diskussion
89
APP-Prozessierung führt. Ein Ansatz ist, mithilfe eines Multi Elisa Systems den
Einfluss von inhibitorischer GGA-RNA auf das extrazelluläre Vorkommen von
sAPPα und sAPPβ zu beobachten und auch zu überprüfen, ob eine erhöhte
Expression von GGAs zu einem entgegengesetzten Ergebnis führt. Wenn diese
Daten konstant und überzeugend sind, und die physiologischen Funktionen der
GGAs aufgeklärt sind, kann darüber nachgedacht werden, ob vielleicht die GGAProteine ein sinnvoller Ansatzpunkt für eine medikamentöse Therapie der
Alzheimer Erkrankung sind.
Solange aber potentielle Zwischenschritte des Transportes und unbekannte
Interaktionspartner und Einflussfaktoren noch nicht identifiziert sind, lassen sich
bisher nur begrenzt Aussagen über die molekularen Ursachen der Alzheimer
Erkrankung treffen.
4.4 Ausblicke in der Therapie
Heute gilt als anerkannt, dass durch die epidemiologische Entwicklung der
Bevölkerungen in den Industrienationen die Zahl der alten Menschen immer weiter
zunehmen wird. Da das Alter als wichtigster Risikofaktor für die Alzheimer
Erkrankung gilt, werden die Zahlen der Betroffenen in den nächsten Jahren
deutlich steigen.
Da die Alzheimer Erkrankung inzwischen im Bewusstsein der Bevölkerung
angekommen ist und auch die Diagnostik fortgeschritten ist, werden immer mehr
Menschen mit dieser Krankheit diagnostiziert. Die Standardtherapie der
Erkrankung wurde bereits beschrieben, hier soll kritisch auf die neusten
Erkenntnisse und Bemühungen hinsichtlich der medikamentösen Therapie
eingegangen werden.
Vor
allem
die
aktive
und
passive
Immunisierung
gegen
Aβ
scheint
vielversprechende Ergebnisse zu erzielen. Die Studien unterscheiden sich
hinsichtlich
ihres
Aufbaus
und
ihrer
Durchführung.
Nachdem
die
tierexperimentellen Studien hinreichende Erfolge sowohl hinsichtlich der
Aβ-Reduktion als auch der kognitiven Befindlichkeit zeigten, wurde eine Phase I
Studie mit AN1792 (einem Aβ42 Präparat) durchgeführt (Bayer et al. 2005).
Während verschiedener Phase II-Studien kam es bei einigen Patienten zur
4 Diskussion
90
Entwicklung einer Meningoenzephalitis (Nicoll et al. 2003; Orgogozo et al. 2003).
Nach Modifikation der Impfstoffe und Erreichen eines höheren Antikörper Titers
konnte gezeigt werden, dass eine Immunisierung mit Aβ42 in einer randomisierten
klinischen Studie zwar deutlich das Vorkommen von Aβ in den Patientengehirnen
reduzierte. Die Neurodegeneration und der kognitive Verfall konnte aber bei
keinem der Patienten aufgehalten werden (Holmes et al. 2008). Obwohl viele
Arbeitsgruppen und Pharmafirmen an diesen Studien beteiligt sind bleibt fraglich,
ob die Impfung gegen die Alzheimer Erkrankung tatsächlich den erwarteten
großen
Erfolg
bringen
wird,
da
der
Ansatzpunkt
zu
spät
in
der
pathophysiologischen Entwicklung der Krankheit ansetzt.
Da BACE das ausschlaggebende Enzym in der amyloidogenen Prozessierung von
APP ist, beinhalten viele denkbare therapeutische Ansätze die Inhibierung von
BACE. Auch eine Unterdrückung der γ-Sekretase und die Hochregulierung von αSekretase werden untersucht. Vor allem die Inhibition von BACE zeigt in
Laborexperimenten große Erfolge (Yoon et al. 2006). Es wurden auch einige
potente und selektive γ-Sekretase Inhibitoren beschrieben, die die Produktion von
Aβ 40 und Aβ 42 sowohl in vitro, als auch in transgenen Mäusen reduzieren.
Außerdem konnte ein Abfall der Aβ-Konzentrationen in Mäusegehirnen festgestellt
werden (Wolfe et al. 1998; Rishton et al. 2000; Shearman et al. 2000; Dovey et al.
2001). Bisher zeigen diese potentiellen Medikamente aber Probleme mit der
Überbrückung der Blut-Hirn-Schranke und zahlreichen Nebenwirkungen.
Diese Arbeit zeigt, dass der Transportweg von BACE vermutlich ein wesentlich
eleganterer und eventuell auch nebenwirkungsärmerer Ansatzpunkt sein könnte.
Cholesterin wird als ein Faktor gehandelt, der den BACE-Transport beeinflusst
(Small und Gandy 2006).
Dementsprechend
korrelieren
hohe
Cholesterinlevel
in
den
meisten
Veröffentlichungen mit einer erhöhten Aβ Produktion sowohl in Zellen als auch in
transgenen Mäusen. Es scheint, dass die BACE und γ-Sekretase Aktivität durch
hohe Cholesterinlevel verstärkt wird (Golde und Eckman 2001). Gleichzeitig hat
sich herausgestellt, dass die Aktivität der α-Sekretase durch zelluläres Cholesterin
gehemmt wird (Bodovitz und Klein 1996). Passend zu diesen Ergebnissen wurde
in epidemiologischen Studien festgestellt, dass Patienten, die mit Inhibitoren der
4 Diskussion
91
Cholesterinbiosynthese behandelt wurden, auch eine erniedrigte Prävalenz der
Alzheimer Erkrankung hatten (Wolozin et al. 2000). Allerdings sind auch diese
Medikamente mit vielen Nebenwirkungen behaftet.
Alle diese Ansatzpunkte zur Therapie haben Nachteile. Sie sind nicht selektiv auf
die Hemmung der Aβ-Produktion ausgelegt, haben zu viele Nebenwirkungen, oder
kommen nicht am eigentlichen Ort ihrer Bestimmung an.
4.5 Schlussfolgerung
Sowohl die Ergebnisse der Konfokalen Lasermikroskopie hinsichtlich der
Lokalisation von BACE, GGA1, GGA2 und GGA3 in der Zelle, als auch die
Tatsache, dass BACE mit allen drei GGA-Proteinen kolokalisiert, unterstützt die
bisher veröffentlichten Daten zu diesen Proteinen.
Die FLIM-Experimente legen eine Interaktion von BACE mit den GGA-Proteinen
nahe und bestätigen die in vitro gefundenen Bindungsdomänen VHS und DXXLL.
Aus diesen Daten kann auf eine ähnliche Funktion hinsichtlich der Interaktion mit
BACE von GGA1, GGA2 und GGA3 geschlossen werden, obwohl sie sich in
Bezug auf Struktur und einige andere physiologische Funktionen unterscheiden.
Die Ergebnisse dieser Arbeit zeigen, wie wichtig die Familie der Transportproteine
und vor allem der GGAs in der Erforschung der Alzheimer Erkrankung in Zukunft
sein werden, sobald die Grundlagenforschung in dieser Krankheit ausreichend
zufriedenstellende Ergebnisse liefert.
5 Zusammenfassung
92
5 Zusammenfassung
Einleitung
Amyloidβ-Plaques sind eine der pathologischen Marker der Alzheimer Erkrankung,
die aufgrund der demographischen Entwicklung in den Industrienationen immer
mehr in den Fokus der gesellschaftlichen und wissenschaftlichen Aufmerksamkeit
rückt. Ihre Produktion wird durch die sequentielle Prozessierung des Amyloid
Precursor Proteins (APP) verursacht. BACE (β-site of APP-cleaving enzyme) ist
bekannt dafür, dass es APP schneidet, worauf eine spätere Prozessierung durch
die
γ-Sekretase
akkumulieren
in
erfolgt.
Die
extrazellulären
daraus
resultierenden
Plaques
und
Amyloidβ-Fragmente
verursachen
eine
weitere
Degeneration von Neuronen. APP und BACE haben einen gemeinsamen
Transportweg durch die Zelle. GGA1, ein Mitglied der Golgi-localized γ-earcontaining adenosindiphosphat ribosylation factor binding (GGA) Protein Familie,
interagiert mit BACE in Abhängigkeit von dessen Phosphorylierungsstatus durch
die VHS (Vacuolar Protein Sorting- Hepatocyte Growth Factor Receptor
Substrate- Signal Transducing Adaptor Molecule) -Domäne. Dies findet vor allem
im Golgi-Apparat statt und beeinflusst den Transport von BACE durch die Zelle.
Fragestellung
Die bisherige Forschung beschränkte sich meistens auf die Untersuchung von
einzelnen GGA Proteinen und stützte sich vor allem auf die Proteinbiochemie oder
Fluoreszenzmikroskopie mit fixierten Zellen. Deshalb konnte diese Arbeit durch
ein lebendes Zellmodelll bessere Einblicke in die physiologischen Abläufe
gewähren und GGA1, GGA2 und GGA3 gleichermaßen untersuchen.
Diese Arbeit hatte zum Ziel zunächst einen Überblick über die Lokalisation von
BACE und Proteinen der GGA-Familie in der lebenden Zelle geben. Weiterhin
wurde untersucht, ob sich eine Kolokalisation der Proteine mit der Methode der
Konfokalen Laser Mikroskopie nachweisen lässt. In den darauf folgenden
Experimenten sollte eine mögliche Interaktion im lebenden Zellmodelll mit Hilfe der
SLIM (Spectral Lifetime Imaging Microscopy) Methode für GGA1, GGA2 und
GGA3 mit BACE unter Berücksichtigung der potentiellen Bindungsdomäne VHS
und der Aminosäurensequenz DXXLL nachgewiesen werden.
5 Zusammenfassung
93
Methoden
Es wurde die Konfokale Laserscanning Mikroskopie verwendet, die durch ihre
variable Schichtdicke eine gute Auflösung der Zellstrukturen bei gleichzeitiger
guter Fluoreszenzsignalstärke gewährleistet. Um die gewonnen Ergebnisse zu
verifizieren, wurde die SLIM-Methode verwendet. In dieser Technik imponiert eine
Distanz von weniger als 10 nm zwischen zwei Fluorophoren, als eine Abnahme
der Lifetime des Donor-Fluorophors. Dies deutet auf eine Interaktion der beiden
untersuchten Proteine hin.
Ergebnisse
Es konnte eine Kolokalisierung von GGA1, GGA2 und GGA3 mit BACE in
perinukleären Kompartimenten dargestellt werden. In den SLIM-Messungen zeigte
sich eine deutliche Abnahme der Donor-Lifetime, die auf eine Interaktion von allen
drei
GGA-Proteinen
mit
BACE
hinweist.
Durch
die
Durchführung
von
Kontrollexperimenten mit Deletionsmutanten der GGA-Proteine und BACEMutanten konnte gezeigt werden, dass die VHS-Domäne der GGA-Proteine und
das DXXLL-Motiv in BACE die Bindungsstelle zwischen diesen Proteinen darstellt,
da sie zwar noch kolokalisierten, eine potentielle Interaktion aber nicht mehr
nachgewiesen werden konnte.
Diskussion
Sowohl die Ergebnisse der Konfokalen Lasermikroskopie hinsichtlich der
Lokalisation von BACE, GGA1, GGA2 und GGA3 in der Zelle, als auch die
Tatsache, dass BACE mit allen drei GGA-Proteinen kolokalisiert bestätigt die
bisher veröffentlichten Daten zu diesen Proteinen.
Die SLIM-Experimente legen eine Interaktion von BACE mit den GGA-Proteinen
nahe und bestätigen die in vitro gefundenen Bindungsdomänen VHS und DXXLL.
Dennoch stellt sich die Frage, welche physiologischen Funktionen diese Proteine
haben. Vor allem bei den GGAs sind durchaus Eigenschaften bekannt, die eher
auf unterschiedliche Funktionen hinweisen. In dieser Arbeit verhalten sich aber
alle drei im Hinblick auf BACE gleichermaßen. Es müssen in Zukunft vor allem
funktionelle Daten hinsichtlich des Einflusses von GGAs auf den BACE-Transport
und die Prozessierung von APP erworben werden, um medikamentöse
Interventionen in der Alzheimer Erkrankung effektiv gestalten zu können.
6 Literaturverzeichnis
94
6 Literaturverzeichnis
1.
Asai M, Hattori C, Szabo B, Sasagawa N, Maruyama K, Tanuma S, Ishiura
S: Putative function of ADAM9, ADAM10, and ADAM17 as APP alphasecretase. Biochem Biophys Res Commun 301: 231-235 (2003)
2.
Bakchine S und Loft H: Memantine treatment in patients with mild to
moderate Alzheimer's disease: results of a randomised, double-blind,
placebo-controlled 6-month study. J Alzheimers Dis 13: 97-107 (2008)
3.
Bayer A J, Bullock R, Jones R W, Wilkinson D, Paterson K R, Jenkins L,
Millais S B, Donoghue S: Evaluation of the safety and immunogenicity of
synthetic Abeta42 (AN1792) in patients with AD. Neurology 64: 94-101
(2005)
4.
Bennett B D, Denis P, Haniu M, Teplow D B, Kahn S, Louis J C, Citron M,
Vassar R: A furin-like convertase mediates propeptide cleavage of BACE, the
Alzheimer's beta -secretase. J Biol Chem 275: 37712-37717 (2000)
5.
Berghammer H und Auer B: "Easypreps": fast and easy plasmid
minipreparation for analysis of recombinant clones in E. coli. Biotechniques
14: 524, 528 (1993)
6.
Bickel H: [Dementia syndrome and Alzheimer disease: an assessment of
morbidity and annual incidence in Germany]. Gesundheitswesen 62: 211-218
(2000)
7.
Bickel H: [Dementia in advanced age: estimating incidence and health care
costs]. Z Gerontol Geriatr 34: 108-115 (2001)
8.
Bodovitz S und Klein W L: Cholesterol modulates alpha-secretase cleavage
of amyloid precursor protein. J Biol Chem 271: 4436-4440 (1996)
9.
Bonifacino J S: The GGA proteins: adaptors on the move. Nat Rev Mol Cell
Biol 5: 23-32 (2004)
10. Boothby L A und Doering P L: Vitamin C and vitamin E for Alzheimer's
disease. Ann Pharmacother 39: 2073-2080 (2005)
11. Cam J A und Bu G: Modulation of beta-amyloid precursor protein trafficking
and processing by the low density lipoprotein receptor family. Mol
Neurodegener 1: 8 (2006)
6 Literaturverzeichnis
95
12. Capell A, Steiner H, Willem M, Kaiser H, Meyer C, Walter J, Lammich S,
Multhaup G, Haass C: Maturation and pro-peptide cleavage of betasecretase. J Biol Chem 275: 30849-30854 (2000)
13. Castellani R J, Lee H G, Perry G, Smith M A: Antioxidant protection and
neurodegenerative disease: the role of amyloid-beta and tau. Am J
Alzheimers Dis Other Demen 21: 126-130 (2006)
14. Chen W J, Goldstein J L, Brown M S: NPXY, a sequence often found in
cytoplasmic tails, is required for coated pit-mediated internalization of the low
density lipoprotein receptor. J Biol Chem 265: 3116-3123 (1990)
15. Chen Y, Mills J D, Periasamy A: Protein localization in living cells and tissues
using FRET and FLIM. Differentiation 71: 528-541 (2003)
16. Chyung J H und Selkoe D J: Inhibition of receptor-mediated endocytosis
demonstrates generation of amyloid beta-protein at the cell surface. J Biol
Chem 278: 51035-51043 (2003)
17. Creemers J W, Ines Dominguez D, Plets E, Serneels L, Taylor N A, Multhaup
G, Craessaerts K, Annaert W, De Strooper B: Processing of beta-secretase
by furin and other members of the proprotein convertase family. J Biol Chem
276: 4211-4217 (2001)
18. Delank
H
W
und
Gehlen
W:
Degenerative
und
metabolische
Hirnerkrankungen, Basalganglienerkrankungen, Demenzen In: Delank H W
und Gehlen W (Hrsg.) Neurologie, 11. Auflage, Georg Thieme Verlag
Stuttgart New York, S. 214-242 (2006)
19. Dell'Angelica E C, Puertollano R, Mullins C, Aguilar R C, Vargas J D, Hartnell
L M, Bonifacino J S: GGAs: a family of ADP ribosylation factor-binding
proteins related to adaptors and associated with the Golgi complex. J Cell
Biol 149: 81-94 (2000)
20. Doray B, Bruns K, Ghosh P, Kornfeld S A: Autoinhibition of the ligand-binding
site of GGA1/3 VHS domains by an internal acidic cluster-dileucine motif.
Proc Natl Acad Sci U S A 99: 8072-8077 (2002)
21. Doray B, Ghosh P, Griffith J, Geuze H J, Kornfeld S: Cooperation of GGAs
and AP-1 in packaging MPRs at the trans-Golgi network. Science 297: 17001703 (2002)
22. Dovey H F, John V, Anderson J P, Chen L Z, de Saint Andrieu P, Fang L Y,
Freedman S B, Folmer B, Goldbach E, Holsztynska E J, Hu K L, Johnson-
6 Literaturverzeichnis
96
Wood K L, Kennedy S L, Kholodenko D, Knops J E, Latimer L H, Lee M, Liao
Z, Lieberburg I M, Motter R N, Mutter L C, Nietz J, Quinn K P, Sacchi K L,
Seubert P A, Shopp G M, Thorsett E D, Tung J S, Wu J, Yang S, Yin C T,
Schenk D B, May P C, Altstiel L D, Bender M H, Boggs L N, Britton T C,
Clemens J C, Czilli D L, Dieckman-McGinty D K, Droste J J, Fuson K S,
Gitter B D, Hyslop P A, Johnstone E M, Li W Y, Little S P, Mabry T E, Miller F
D, Audia J E: Functional gamma-secretase inhibitors reduce beta-amyloid
peptide levels in brain. J Neurochem 76: 173-181 (2001)
23. Eikelenboom P, Veerhuis R, Scheper W, Rozemuller A J, van Gool W A,
Hoozemans J J: The significance of neuroinflammation in understanding
Alzheimer's disease. J Neural Transm 113: 1685-1695 (2006)
24. Esposito A und Wouters F S: Fluorescence lifetime imaging microscopy. Curr
Protoc Cell Biol Chapter 4: Unit 4 14 (2004)
25. Francis R, McGrath G, Zhang J, Ruddy D A, Sym M, Apfeld J, Nicoll M,
Maxwell M, Hai B, Ellis M C, Parks A L, Xu W, Li J, Gurney M, Myers R L,
Himes C S, Hiebsch R, Ruble C, Nye J S, Curtis D: aph-1 and pen-2 are
required for Notch pathway signaling, gamma-secretase cleavage of
betaAPP, and presenilin protein accumulation. Dev Cell 3: 85-97 (2002)
26. Golde T E und Eckman C B: Cholesterol modulation as an emerging strategy
for the treatment of Alzheimer's disease. Drug Discov Today 6: 1049-1055
(2001)
27. Gong Y, Chang L, Viola K L, Lacor P N, Lambert M P, Finch C E, Krafft G A,
Klein W L: Alzheimer's disease-affected brain: presence of oligomeric A beta
ligands (ADDLs) suggests a molecular basis for reversible memory loss. Proc
Natl Acad Sci U S A 100: 10417-10422 (2003)
28. Grant S G, Jessee J, Bloom F R, Hanahan D: Differential plasmid rescue
from transgenic mouse DNAs into Escherichia coli methylation-restriction
mutants. Proc Natl Acad Sci U S A 87: 4645-4649 (1990)
29. Haass C, Koo E H, Mellon A, Hung A Y, Selkoe D J: Targeting of cell-surface
beta-amyloid precursor protein to lysosomes: alternative processing into
amyloid-bearing fragments. Nature 357: 500-503 (1992)
30. Haass C und Steiner H: Alzheimer disease gamma-secretase: a complex
story of GxGD-type presenilin proteases. Trends Cell Biol 12: 556-562 (2002)
6 Literaturverzeichnis
97
31. Hardy J: Amyloid, the presenilins and Alzheimer's disease. Trends Neurosci
20: 154-159 (1997)
32. He X, Chang W P, Koelsch G, Tang J: Memapsin 2 (beta-secretase)
cytosolic domain binds to the VHS domains of GGA1 and GGA2: implications
on the endocytosis mechanism of memapsin 2. FEBS Lett 524: 183-187
(2002)
33. He X, Zhu G, Koelsch G, Rodgers K K, Zhang X C, Tang J: Biochemical and
structural characterization of the interaction of memapsin 2 (beta-secretase)
cytosolic domain with the VHS domain of GGA proteins. Biochemistry 42:
12174-12180 (2003)
34. Helzner E P, Scarmeas N, Cosentino S, Tang M X, Schupf N, Stern Y:
Survival in Alzheimer disease: a multiethnic, population-based study of
incident cases. Neurology 71: 1489-1495 (2008)
35. Herz J und Strickland D K: LRP: a multifunctional scavenger and signaling
receptor. J Clin Invest 108: 779-784 (2001)
36. Hirst J, Lui W W, Bright N A, Totty N, Seaman M N, Robinson M S: A family
of proteins with gamma-adaptin and VHS domains that facilitate trafficking
between the trans-Golgi network and the vacuole/lysosome. J Cell Biol 149:
67-80 (2000)
37. Holmes C, Boche D, Wilkinson D, Yadegarfar G, Hopkins V, Bayer A, Jones
R W, Bullock R, Love S, Neal J W, Zotova E, Nicoll J A: Long-term effects of
Abeta42 immunisation in Alzheimer's disease: follow-up of a randomised,
placebo-controlled phase I trial. Lancet 372: 216-223 (2008)
38. Holtzman D M, Bales K R, Tenkova T, Fagan A M, Parsadanian M, Sartorius
L J, Mackey B, Olney J, McKeel D, Wozniak D, Paul S M: Apolipoprotein E
isoform-dependent amyloid deposition and neuritic degeneration in a mouse
model of Alzheimer's disease. Proc Natl Acad Sci U S A 97: 2892-2897
(2000)
39. Hsiao K, Chapman P, Nilsen S, Eckman C, Harigaya Y, Younkin S, Yang F,
Cole G: Correlative memory deficits, Abeta elevation, and amyloid plaques in
transgenic mice. Science 274: 99-102 (1996)
40. Huse J T, Pijak D S, Leslie G J, Lee V M, Doms R W: Maturation and
endosomal targeting of beta-site amyloid precursor protein-cleaving enzyme.
6 Literaturverzeichnis
98
The Alzheimer's disease beta-secretase. J Biol Chem 275: 33729-33737
(2000)
41. Hussain I, Powell D, Howlett D R, Tew D G, Meek T D, Chapman C, Gloger I
S, Murphy K E, Southan C D, Ryan D M, Smith T S, Simmons D L, Walsh F
S, Dingwall C, Christie G: Identification of a novel aspartic protease (Asp 2)
as beta-secretase. Mol Cell Neurosci 14: 419-427 (1999)
42. Kametaka S, Mattera R, Bonifacino J S: Epidermal growth factor-dependent
phosphorylation of the GGA3 adaptor protein regulates its recruitment to
membranes. Mol Cell Biol 25: 7988-8000 (2005)
43. Kinoshita A, Fukumoto H, Shah T, Whelan C M, Irizarry M C, Hyman B T:
Demonstration by FRET of BACE interaction with the amyloid precursor
protein at the cell surface and in early endosomes. J Cell Sci 116: 3339-3346
(2003)
44. Kivipelto M, Rovio S, Ngandu T, Kareholt I, Eskelinen M, Winblad B,
Hachinski V, Cedazo-Minguez A, Soininen H, Tuomilehto J, Nissinen A:
Apolipoprotein E epsilon4 Magnifies Lifestyle Risks for Dementia: A
Population Based Study. J Cell Mol Med(2008)
45. Koh Y H, von Arnim C A, Hyman B T, Tanzi R E, Tesco G: BACE is
degraded via the lysosomal pathway. J Biol Chem 280: 32499-32504 (2005)
46. Koo E H und Squazzo S L: Evidence that production and release of amyloid
beta-protein involves the endocytic pathway. J Biol Chem 269: 17386-17389
(1994)
47. Koo E H, Squazzo S L, Selkoe D J, Koo C H: Trafficking of cell-surface
amyloid beta-protein precursor. I. Secretion, endocytosis and recycling as
detected by labeled monoclonal antibody. J Cell Sci 109 ( Pt 5): 991-998
(1996)
48. Kounnas M Z, Moir R D, Rebeck G W, Bush A I, Argraves W S, Tanzi R E,
Hyman B T, Strickland D K: LDL receptor-related protein, a multifunctional
ApoE receptor, binds secreted beta-amyloid precursor protein and mediates
its degradation. Cell 82: 331-340 (1995)
49. Kress M, Meier T, Steiner R, Dolp F, Erdmann R, Ortmann U, Ruck A: Timeresolved microspectrofluorometry and fluorescence lifetime imaging of
photosensitizers using picosecond pulsed diode lasers in laser scanning
microscopes. J Biomed Opt 8: 26-32 (2003)
6 Literaturverzeichnis
99
50. LaDu M J, Falduto M T, Manelli A M, Reardon C A, Getz G S, Frail D E:
Isoform-specific binding of apolipoprotein E to beta-amyloid. J Biol Chem
269: 23403-23406 (1994)
51. Lakowicz J R, Szmacinski H, Nowaczyk K, Berndt K W, Johnson M:
Fluorescence lifetime imaging. Anal Biochem 202: 316-330 (1992)
52. Larson E B, Shadlen M F, Wang L, McCormick W C, Bowen J D, Teri L,
Kukull W A: Survival after initial diagnosis of Alzheimer disease. Ann Intern
Med 140: 501-509 (2004)
53. Levy-Lahad E, Wijsman E M, Nemens E, Anderson L, Goddard K A, Weber J
L, Bird T D, Schellenberg G D: A familial Alzheimer's disease locus on
chromosome 1. Science 269: 970-973 (1995)
54. Li L, Gryczynski I, Lakowicz J R: Resonance energy transfer study using a
rhenium metal-ligand lipid conjugate as the donor in a model membrane.
Chem Phys Lipids 101: 243-253 (1999)
55. Li Y, Cam J, Bu G: Low-density lipoprotein receptor family: endocytosis and
signal transduction. Mol Neurobiol 23: 53-67 (2001)
56. Lin X, Koelsch G, Wu S, Downs D, Dashti A, Tang J: Human aspartic
protease memapsin 2 cleaves the beta-secretase site of beta-amyloid
precursor protein. Proc Natl Acad Sci U S A 97: 1456-1460 (2000)
57. Luchowski R, Matveeva E G, Gryczynski I, Terpetschnig E A, Patsenker L,
Laczko G, Borejdo J, Gryczynski Z: Single molecule studies of multiplefluorophore labeled antibodies. Effect of homo-FRET on the number of
photons available before photobleaching. Curr Pharm Biotechnol 9: 411-420
(2008)
58. Mattson M P: Pathways towards and away from Alzheimer's disease. Nature
430: 631-639 (2004)
59. McKay M M und Kahn R A: Multiple phosphorylation events regulate the
subcellular localization of GGA1. Traffic 5: 102-116 (2004)
60. McShane R, Areosa Sastre A, Minakaran N: Memantine for dementia.
Cochrane Database Syst Rev: CD003154 (2006)
61. Moreira P I, Santos M S, Oliveira C R, Shenk J C, Nunomura A, Smith M A,
Zhu X, Perry G: Alzheimer disease and the role of free radicals in the
pathogenesis of the disease. CNS Neurol Disord Drug Targets 7: 3-10 (2008)
6 Literaturverzeichnis
100
62. Naslund J, Haroutunian V, Mohs R, Davis K L, Davies P, Greengard P,
Buxbaum J D: Correlation between elevated levels of amyloid beta-peptide in
the brain and cognitive decline. Jama 283: 1571-1577 (2000)
63. Nicoll J A, Wilkinson D, Holmes C, Steart P, Markham H, Weller R O:
Neuropathology of human Alzheimer disease after immunization with
amyloid-beta peptide: a case report. Nat Med 9: 448-452 (2003)
64. Ohno M, Sametsky E A, Younkin L H, Oakley H, Younkin S G, Citron M,
Vassar R, Disterhoft J F: BACE1 deficiency rescues memory deficits and
cholinergic dysfunction in a mouse model of Alzheimer's disease. Neuron 41:
27-33 (2004)
65. Olmsted J B, Carlson K, Klebe R, Ruddle F, Rosenbaum J: Isolation of
microtubule protein from cultured mouse neuroblastoma cells. Proc Natl
Acad Sci U S A 65: 129-136 (1970)
66. Orgogozo J M, Gilman S, Dartigues J F, Laurent B, Puel M, Kirby L C,
Jouanny P, Dubois B, Eisner L, Flitman S, Michel B F, Boada M, Frank A,
Hock C: Subacute meningoencephalitis in a subset of patients with AD after
Abeta42 immunization. Neurology 61: 46-54 (2003)
67. Pastorino L, Ikin A F, Nairn A C, Pursnani A, Buxbaum J D: The carboxylterminus of BACE contains a sorting signal that regulates BACE trafficking
but not the formation of total A(beta). Mol Cell Neurosci 19: 175-185 (2002)
68. Ponten J und Macintyre E H: Long term culture of normal and neoplastic
human glia. Acta Pathol Microbiol Scand 74: 465-486 (1968)
69. Riddell D R, Christie G, Hussain I, Dingwall C: Compartmentalization of betasecretase (Asp2) into low-buoyant density, noncaveolar lipid rafts. Curr Biol
11: 1288-1293 (2001)
70. Rishton G M, Retz D M, Tempest P A, Novotny J, Kahn S, Treanor J J, Lile J
D, Citron M: Fenchylamine sulfonamide inhibitors of amyloid beta peptide
production by the gamma-secretase proteolytic pathway: potential smallmolecule therapeutic agents for the treatment of Alzheimer's disease. J Med
Chem 43: 2297-2299 (2000)
71. Roberds S L, Anderson J, Basi G, Bienkowski M J, Branstetter D G, Chen K
S, Freedman S B, Frigon N L, Games D, Hu K, Johnson-Wood K,
Kappenman K E, Kawabe T T, Kola I, Kuehn R, Lee M, Liu W, Motter R,
Nichols N F, Power M, Robertson D W, Schenk D, Schoor M, Shopp G M,
6 Literaturverzeichnis
101
Shuck M E, Sinha S, Svensson K A, Tatsuno G, Tintrup H, Wijsman J, Wright
S, McConlogue L: BACE knockout mice are healthy despite lacking the
primary beta-secretase activity in brain: implications for Alzheimer's disease
therapeutics. Hum Mol Genet 10: 1317-1324 (2001)
72. Ruck A, Hulshoff C, Kinzler I, Becker W, Steiner R: SLIM: a new method for
molecular imaging. Microsc Res Tech 70: 485-492 (2007)
73. Shearman M S, Beher D, Clarke E E, Lewis H D, Harrison T, Hunt P, Nadin
A, Smith A L, Stevenson G, Castro J L: L-685,458, an aspartyl protease
transition state mimic, is a potent inhibitor of amyloid beta-protein precursor
gamma-secretase activity. Biochemistry 39: 8698-8704 (2000)
74. Shiba T, Kametaka S, Kawasaki M, Shibata M, Waguri S, Uchiyama Y,
Wakatsuki S: Insights into the phosphoregulation of beta-secretase sorting
signal by the VHS domain of GGA1. Traffic 5: 437-448 (2004)
75. Sinha S, Anderson J P, Barbour R, Basi G S, Caccavello R, Davis D, Doan
M, Dovey H F, Frigon N, Hong J, Jacobson-Croak K, Jewett N, Keim P,
Knops J, Lieberburg I, Power M, Tan H, Tatsuno G, Tung J, Schenk D,
Seubert P, Suomensaari S M, Wang S, Walker D, Zhao J, McConlogue L,
John V: Purification and cloning of amyloid precursor protein beta-secretase
from human brain. Nature 402: 537-540 (1999)
76. Sinha S und Lieberburg I: Cellular mechanisms of beta-amyloid production
and secretion. Proc Natl Acad Sci U S A 96: 11049-11053 (1999)
77. Small S A und Gandy S: Sorting through the cell biology of Alzheimer's
disease: intracellular pathways to pathogenesis. Neuron 52: 15-31 (2006)
78. Smith M A, Casadesus G, Joseph J A, Perry G: Amyloid-beta and tau serve
antioxidant functions in the aging and Alzheimer brain. Free Radic Biol Med
33: 1194-1199 (2002)
79. Spoelgen R, von Arnim C A, Thomas A V, Peltan I D, Koker M, Deng A,
Irizarry M C, Andersen O M, Willnow T E, Hyman B T: Interaction of the
cytosolic domains of sorLA/LR11 with the amyloid precursor protein (APP)
and beta-secretase beta-site APP-cleaving enzyme. J Neurosci 26: 418-428
(2006)
80. Takasugi N, Tomita T, Hayashi I, Tsuruoka M, Niimura M, Takahashi Y,
Thinakaran G, Iwatsubo T: The role of presenilin cofactors in the gammasecretase complex. Nature 422: 438-441 (2003)
6 Literaturverzeichnis
102
81. Tesco G, Koh Y H, Kang E L, Cameron A N, Das S, Sena-Esteves M,
Hiltunen M, Yang S H, Zhong Z, Shen Y, Simpkins J W, Tanzi R E: Depletion
of GGA3 stabilizes BACE and enhances beta-secretase activity. Neuron 54:
721-737 (2007)
82. Thomas A V, Berezovska O, Hyman B T, von Arnim C A: Visualizing
interaction of proteins relevant to Alzheimer's disease in intact cells. Methods
44: 299-303 (2008)
83. Trommsdorff M, Borg J P, Margolis B, Herz J: Interaction of cytosolic adaptor
proteins with neuronal apolipoprotein E receptors and the amyloid precursor
protein. J Biol Chem 273: 33556-33560 (1998)
84. Vassar R, Bennett B D, Babu-Khan S, Kahn S, Mendiaz E A, Denis P,
Teplow D B, Ross S, Amarante P, Loeloff R, Luo Y, Fisher S, Fuller J,
Edenson S, Lile J, Jarosinski M A, Biere A L, Curran E, Burgess T, Louis J C,
Collins F, Treanor J, Rogers G, Citron M: Beta-secretase cleavage of
Alzheimer's amyloid precursor protein by the transmembrane aspartic
protease BACE. Science 286: 735-741 (1999)
85. von Arnim C A, Kinoshita A, Peltan I D, Tangredi M M, Herl L, Lee B M,
Spoelgen R, Hshieh T T, Ranganathan S, Battey F D, Liu C X, Bacskai B J,
Sever S, Irizarry M C, Strickland D K, Hyman B T: The low density lipoprotein
receptor-related protein (LRP) is a novel beta-secretase (BACE1) substrate.
J Biol Chem 280: 17777-17785 (2005)
86. von Arnim C A, Spoelgen R, Peltan I D, Deng M, Courchesne S, Koker M,
Matsui T, Kowa H, Lichtenthaler S F, Irizarry M C, Hyman B T: GGA1 acts as
a spatial switch altering amyloid precursor protein trafficking and processing.
J Neurosci 26: 9913-9922 (2006)
87. von Arnim C A, Tangredi M M, Peltan I D, Lee B M, Irizarry M C, Kinoshita A,
Hyman B T: Demonstration of BACE (beta-secretase) phosphorylation and
its interaction with GGA1 in cells by fluorescence-lifetime imaging
microscopy. J Cell Sci 117: 5437-5445 (2004)
88. von Arnim C A, von Einem B, Weber P, Wagner M, Schwanzar D, Spoelgen
R, Strauss W L, Schneckenburger H: Impact of cholesterol level upon APP
and BACE proximity and APP cleavage. Biochem Biophys Res Commun
370: 207-212 (2008)
6 Literaturverzeichnis
103
89. von Rotz R C, Kohli B M, Bosset J, Meier M, Suzuki T, Nitsch R M, Konietzko
U: The APP intracellular domain forms nuclear multiprotein complexes and
regulates the transcription of its own precursor. J Cell Sci 117: 4435-4448
(2004)
90. Wahle T, Prager K, Raffler N, Haass C, Famulok M, Walter J: GGA proteins
regulate retrograde transport of BACE1 from endosomes to the trans-Golgi
network. Mol Cell Neurosci 29: 453-461 (2005)
91. Wahle T, Thal D R, Sastre M, Rentmeister A, Bogdanovic N, Famulok M,
Heneka M T, Walter J: GGA1 is expressed in the human brain and affects
the generation of amyloid beta-peptide. J Neurosci 26: 12838-12846 (2006)
92. Walter J, Fluhrer R, Hartung B, Willem M, Kaether C, Capell A, Lammich S,
Multhaup G, Haass C: Phosphorylation regulates intracellular trafficking of
beta-secretase. J Biol Chem 276: 14634-14641 (2001)
93. Wang J Y, Wen L L, Huang Y N, Chen Y T, Ku M C: Dual effects of
antioxidants in neurodegeneration: direct neuroprotection against oxidative
stress and indirect protection via suppression of glia-mediated inflammation.
Curr Pharm Des 12: 3521-3533 (2006)
94. Willem M, Garratt A N, Novak B, Citron M, Kaufmann S, Rittger A,
DeStrooper B, Saftig P, Birchmeier C, Haass C: Control of peripheral nerve
myelination by the beta-secretase BACE1. Science 314: 664-666 (2006)
95. Wolfe M S, Citron M, Diehl T S, Xia W, Donkor I O, Selkoe D J: A substratebased difluoro ketone selectively inhibits Alzheimer's gamma-secretase
activity. J Med Chem 41: 6-9 (1998)
96. Wolfe M S und Kopan R: Intramembrane proteolysis: theme and variations.
Science 305: 1119-1123 (2004)
97. Wolfe M S, Xia W, Ostaszewski B L, Diehl T S, Kimberly W T, Selkoe D J:
Two transmembrane aspartates in presenilin-1 required for presenilin
endoproteolysis and gamma-secretase activity. Nature 398: 513-517 (1999)
98. Wolfson C, Wolfson D B, Asgharian M, M'Lan C E, Ostbye T, Rockwood K,
Hogan D B: A reevaluation of the duration of survival after the onset of
dementia. N Engl J Med 344: 1111-1116 (2001)
99. Wolozin B, Kellman W, Ruosseau P, Celesia G G, Siegel G: Decreased
prevalence of Alzheimer disease associated with 3-hydroxy-3-methyglutaryl
coenzyme A reductase inhibitors. Arch Neurol 57: 1439-1443 (2000)
6 Literaturverzeichnis
104
100. Xia W, Ray W J, Ostaszewski B L, Rahmati T, Kimberly W T, Wolfe M S,
Zhang J, Goate A M, Selkoe D J: Presenilin complexes with the C-terminal
fragments of amyloid precursor protein at the sites of amyloid beta-protein
generation. Proc Natl Acad Sci U S A 97: 9299-9304 (2000)
101. Xie L, Boyle D, Sanford D, Scherer P E, Pessin J E, Mora S: Intracellular
trafficking and secretion of adiponectin is dependent on GGA-coated
vesicles. J Biol Chem 281: 7253-7259 (2006)
102. Yamazaki T, Koo E H, Selkoe D J: Trafficking of cell-surface amyloid betaprotein precursor. II. Endocytosis, recycling and lysosomal targeting detected
by immunolocalization. J Cell Sci 109 ( Pt 5): 999-1008 (1996)
103. Yan R, Bienkowski M J, Shuck M E, Miao H, Tory M C, Pauley A M, Brashier
J R, Stratman N C, Mathews W R, Buhl A E, Carter D B, Tomasselli A G,
Parodi L A, Heinrikson R L, Gurney M E: Membrane-anchored aspartyl
protease with Alzheimer's disease beta-secretase activity. Nature 402: 533537 (1999)
104. Yoon S Y, Choi J E, Yoon J H, Huh J W, Kim D H: BACE inhibitor reduces
APP-beta-C-terminal fragment accumulation in axonal swellings of okadaic
acid-induced neurodegeneration. Neurobiol Dis 22: 435-444 (2006)
105. Young-Pearse T L, Chen A C, Chang R, Marquez C, Selkoe D J: Secreted
APP regulates the function of full-length APP in neurite outgrowth through
interaction with integrin beta1. Neural Develop 3: 15 (2008)
106. Zhang F, Yim Y I, Scarselletta S, Norton M, Eisenberg E, Greene L E:
Clathrin adaptor GGA1 polymerizes clathrin into tubules. J Biol Chem 282:
13282-13289 (2007)
Anhang
105
Abbildungsverzeichnis:
Abb. 1: Schematische Darstellung von Plaques und Tangles (American Health
Assistance Foundation, www.ahaf.org/alzdis/about/plaques_tangles.jpg)... 4
Abb. 2: Die nicht amyloidogene Prozessierung des Amyloid Precursor Proteins ... 7
Abb. 3: Die amyloidogene Prozessierung des Amyloid Precursor Proteins ........... 9
Abb. 4: β-site of Amyloid Precursor Protein Cleaving Enzyme (BACE)................ 11
Abb. 5: Die drei Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation
factor-binding Proteine (GGA) schematisch dargestellt ............................. 13
Abb. 6: Golgi-localized, γ-ear-containing, Adenosindiphosphat-ribosylation factorbinding protein (GGA) und seine Domänen (Bonifacino 2004) .................. 14
Abb. 7: Transport des Amyloid Precursor Proteins (APP) und β-site of APP
cleaving-enzyme
(BACE)
durch
Golgi-localized,
γ-ear-containing,
Adenosindiphosphat-ribosylation factor-binding protein 1 (GGA1) (Wahle et
al. 2006)..................................................................................................... 18
Abb. 8: β- Amyloid- Cleaving Enzym (BACE)- EGFP Plasmid DNA..................... 23
Abb. 9: Exzitation und Emission der Fluorophore Enhanced Green Fluorescent
Protein (EGFP) und modifiziertes Red Fluorescent Protein (mRFP)
(Invitrogen Fluorescence Spectra Viewer, www.invitrogen.com) ............... 24
Abb. 10: Prinzip des Metatrackings durch den META-Detektor (Carl Zeiss
MicroImaging GmbH)................................................................................. 35
Abb. 11: Übertragung der Energie von Donor- auf Akzeptor- Fluorophor
(Bedienungsanleitung für SPCImage 2.8, September 2006, Becker und
Hickl).......................................................................................................... 36
Abb. 12: Abnahme der Lifetime (Quenching) eines Fluorophores nach Exzitation
durch einen Laser-Impuls durch Energie Transfer (Bedienungsanleitung für
SPCImage 2.8, September 2006, Becker und Hickl) ................................. 37
Abb. 13: Schematische Darstellung der Spektralen Lifetime Imaging Microscopy
(SLIM) (Bedienungsanleitung für SPCImage 2.8, September 2006, Becker
und Hickl)................................................................................................... 39
Abb. 14: Lokalisation und Kolokalisation GGA1, GGA2 und GGA3 in U373-Zellen
in der Konfokalen Laserscanning Mikroskopie........................................... 45
Abb. 15: Lokalisation und Kolokalisation von GGA1, GGA2 und GGA3 mit BACE
in
N2A-Zellen
und
U373-Zellen
in
der
Konfokalen
Laserscanning
Mikroskopie................................................................................................ 47
Anhang
106
Abb. 16: BACE -mRFP Einzeltransfektion............................................................ 49
Abb. 17: Lokalisation und Kolokalisation von ∆- VHS-GGA1, ∆-VHS-GGA2, ∆VHS-GGA3 mit BACE in U373-Zellen in der Konfokalen Laserscanning
Mikroskopie................................................................................................ 50
Abb. 18: BACE(LL499/50AA)-EGFP Einzeltransfektion ....................................... 52
Abb. 19: Lokalisation und Kolokalisation von GGA1, GGA2 und GGA3 mit
BACE(LL499/500AA) in U373-Zellen in der Konfokalen Laserscanning
Mikroskopie................................................................................................ 53
Abb. 20: Statistik: GGA1 (Wildtyp und als ∆-VHS-Variante) und BACE ............... 56
Abb. 21: Repräsentative Zellen: GGA1 (Wildtyp und als ∆-VHS-Variante) und
BACE ......................................................................................................... 58
Abb. 22: Statistik: GGA2 (Wildtyp und als ∆-VHS-Variante) und BACE ............... 60
Abb. 23: Repräsentative Zellen: GGA2 (Wildtyp und als ∆-VHS-Variante) und
BACE ......................................................................................................... 62
Abb. 24: Statistik: GGA3 (Wildtyp und als ∆-VHS-Variante) und BACE ............... 64
Abb. 25: Repräsentative Zellen: GGA3 (Wildtyp und als ∆-VHS-Variante) und
BACE ......................................................................................................... 65
Abb. 26: Statistik: GGA1 und BACE (Wildtyp und als LL499/500AA- Variation) .. 68
Abb. 27: Repräsentative Zellen: GGA1 und BACE (Wildtyp und als LL499/500AAVariation) ................................................................................................... 69
Abb. 28: Statistik: GGA2 und BACE (Wildtyp und als LL499/500AA- Variation) .. 71
Abb. 29: Repräsentative Zellen: GGA2 und BACE (Wildtyp und als LL499/500AAVariation) ................................................................................................... 72
Abb. 30: Statistik: GGA3 und BACE (Wildtyp und als LL499/500AA- Variation) .. 74
Abb. 31: Repräsentative Zellen: GGA3 und BACE (Wildtyp und als LL499/500AAVariation) ................................................................................................... 75
Anhang
107
Tabellenverzeichnis:
Tabelle 1: Moleküle, die den Transportweg von APP und BACE möglicherweise
beeinflussen............................................................................................... 16
Tabelle 2: Bakterienstämme................................................................................. 21
Tabelle 3: Zellinien ............................................................................................... 21
Tabelle 4: DNA- Vektoren .................................................................................... 22
Tabelle 5: Living Color Tags................................................................................. 23
Tabelle 6: Oligonukleotide (B. von Einem) ........................................................... 24
Tabelle 7: Enzyme und Enzympuffer.................................................................... 25
Tabelle 8: Fragmentlängenstandards................................................................... 25
Tabelle 9: Bakterienkulturmedien/ Zellkulturmedien............................................. 26
Tabelle 10: Antibiotika .......................................................................................... 26
Tabelle 11: Verwendete Kits................................................................................. 26
Tabelle 12: Computer Programme ....................................................................... 27
Tabelle 13: Transfektionsansatz: Lokalisation der GGAs..................................... 44
Tabelle 14: Transfektionsansatz: Kolokalisation von GGAs mit BACE................. 46
Tabelle 15: Transfektionsansatz: ∆-VHS-GGAs und BACE ................................. 49
Tabelle 16: Transfektionsansatz: BACE(LL499/500A) mit GGAs......................... 51
Tabelle 17: Transfektionsansatz: SLIM Experimente mit ∆VHS-GGAs als Kontrolle
................................................................................................................... 55
Tabelle 18: Transfektionsansatz: SLIM Experimente mit BACE(LL499/500A) als
Kontrolle..................................................................................................... 67
Anhang
108
Danksagung:
Ich möchte mich zunächst herzlich bei Christine von Arnim für die Betreuung
dieser Doktorarbeit bedanken.
Auch ein herzliches Dankeschön an das Labor-Team für Unterstützung, Tipps und
Korrekturlesen: Björn von Einem, Silke Beyer und Daniel Schwanzar.
Bei Angelika Rück und Frank Dolp vom ILM möchte ich mich für die Kooperation
und Hilfe bei den SLIM-Experimenten bedanken.
Bei meiner Familie und Freunden für die aufbauenden Worte.
Danke.
Anhang
109
Lebenslauf:
Persönliche Daten:
Name: Cornelia Steinmetz
E-Mail: cornelia.steinmetz@uni-ulm.de
Geburtsdatum: 03.02.1984
Geburtsort: Freiburg im Breisgau
Eltern: Edwin H. Steinmetz (Dipl.Ing), Christine J. Paarmann-Steinmetz (Dipl.Ing)
Geschwister: Claudia Steinmetz
Schulausbildung:
1990-1994: Grundschule Neuershausen
1994-1997: St. Ursula Gymnasium in Freiburg
1997-2000: Albert-Schweitzer-Gymnasium in Gundelfingen
2000-2001: St. Mary’s High School in Medford, Oregon, USA
2001-2003: Albert-Schweitzer-Gymnasium in Gundelfingen
Schulabschluss: High School Diploma (GPA: 4.03)
Abitur (Note: 1,1)
Hochschulstudium:
Seit 10/03: Studium Humanmedizin Universität Ulm
09/05: Erster Abschnitt der ärztlichen Prüfung (Note: 2,0)
09/06- 05/07: Stipendium des Promotionsprogrammes Experimentelle Medizin im
Rahmen der Doktorarbeit
Abschluss: Staatsexamen Humanmedizin im Frühjahr 2010
Doktorarbeit:
Thema: GGA-Proteine und ihr Einfluss auf den BACE-Transport in der Alzheimer
Erkrankung
Abteilung: Experimentelle Neurologie Universität Ulm
Betreuer: Fr. Prof. Dr. C. von Arnim
Anhang
110
Publikationen:
Poster:
Neuroscience, November 2007, San Diego, USA: “Visualizing interaction of BACE
and GGAs” (B.v.Einem, C.Steinmetz, C.v.Arnim, A.Rück, F.Dolp)
International Graduate School in Molecular Medicine, April 2008, Ulm: “The role of
the GGA protein family in Alzheimer’s disease” (B.v.Einem, C.Steinmetz,
C.v.Arnim, T. Böckers, A.Rück, F.Dolp)
International Conference on Alzheimer’s Disease, Juli 2008, Chicago, USA:” The
role of the GGA protein family upon BACE transport in Alzheimer’s disease”
(B.v.Einem, C.Steinmetz, D.Schwanzar, C.v.Arnim, A.Rück, F.Dolp)
Vorträge:
81. Kongress der Deutschen Gesellschaft für Neurologie, September 2008,
Hamburg: “The involvement of the GGA protein family in BACE transport and APP
processing in Alzheimer’s disease“ (C.Steinmetz, C. v. Arnim, S. Lintner, A.Rück,
F.Dolp, B.v.Einem, D. Schwanzar)
Photonics West, Januar 2008, San Jose, USA: “Spectrally resolved fluorescence
lifetime imaging” (A.Rück, F.Dolp, B.v.Einem, C.Steinmetz, C. v. Arnim)
Advanced Multiphoton and Fluorescence Lifetime Imaging, 2008, Boston, USA:
“SLIM for multicpectral FRET imaging” (A.Rück, F.Dolp, B.v.Einem, C.Steinmetz,
C. v. Arnim, S. Lintner)
Advanced Multiphoton and Fluorescence Lifetime Imaging, 2008, Berkley, USA:
“SLIM: multicpectral FLIM with wide applications in cell biology” (A.Rück, F.Dolp, ,
C.Steinmetz, B.v.Einem, C. v. Arnim)
Advanced
Multiphoton
and
Fluorescence
Lifetime
Imaging,
Juni
2008,
Saarbrücken: “New applications for spectrally resolved fluorescence lifetime
imaging” (A.Rück, F.Dolp, C.Steinmetz, B.v.Einem, C. v. Arnim)
Anhang
111
Paper:
A.Rück, F.Dolp, R.Steiner, C.Steinmetz, B.v.Einem, C.v.Arnim (2008), “SLIM for
multispectral FRET imaging“, Multiphoton Microscopy in the Biomedical Sciences
8, Proc. of SPIE Vol.6860, 68601F
A.Rück, F.Dolp, C.Steinmetz, B.v.Einem, C.v.Arnim (2009), “SLIM: multispectral
FLIM with wide applications in cell biology“, Proc. of SPIE (Article in press)
Praktika:
09/04: Tutorentraining Anamnesegruppe in Wien
02/06- 04/06: Famulatur Universitätsklinik Freiburg (Psychiatrie)
09/06- 10/06: Famulatur Universitätsklinik Szeged, Ungarn (Gynäkologie,
Chirurgie)
04/07: Symposium “High-Performance Fluorescence Imaging in the Life Science“
SS07: EKG- Grundkurs Uni Ulm
SS07: Sonographie- Vorlesung Uni Ulm
08/07: Famulatur Universitätsklinik Ulm (Neurologie Ambulanz)
Sonstige Tätigkeiten:
SS04: Tutor Begleitkurs Histologie (unentgeltlich)
WS05/06-SS08: HiWi: Tutor Anamnesegruppe (Abteilung Psychosomatik)
WS05/06: HiWi: Tutor EKG- Praktikum (Abteilung Physiologie)
SS06: HiWi: Tutor Histologie Kurs (Abteilung Anatomie)
SS06: HiWi: Tutor Psychologie Kurs (Abteilung Psychosomatik)
WS07/08: HiWi: Staatsexamen Kurs (Abteilung Neurologie)
WS08/09: HiWi: Evaluation Dekanat der Medizinischen Fakultät
Fremdsprachen:
Englisch: fließend
Französisch: 6 Jahre
Latein: 2 Jahre (Latinum)
Spanisch: 1Jahr
Ulm, 27.01.2009, Cornelia Steinmetz
Document
Kategorie
Kunst und Fotos
Seitenansichten
20
Dateigröße
3 527 KB
Tags
1/--Seiten
melden