close

Anmelden

Neues Passwort anfordern?

Anmeldung mit OpenID

Kennedy Syndrom: Was haben wir über diese - Muskelatrophie

EinbettenHerunterladen
Kennedy Syndrom:
Was haben wir über diese
Krankheit gelernt und was
werden wir damit anfangen?
SBMA wird verursacht durch erhöhte Anzahl von CAGWiederholungen im Androgenrezeptor-Gen (AR-Gen):
CTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
GCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAA
SBMA
CTGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGAA
Normal
Da CAG Glutamin verschlüsselt, resultiert die
erhöhte Anzahl an CAG Wiederholungen im Gen
in einer Polyglutamin-Erweiterung im AR-Protein.
Der Androgenrezeptor bindet an Androgene und
dann an die DNA, wo er Zielgene aktiviert:
Androgene:
Testosteron
Dihydrotestosteron
Androgenrezeptor
DNA
Repeat-Erweiterungen im AR verursachen sowohl
Verlust als auch Gewinn an Rezeptorfunktion:
Androgenrezeptor
PolyglutaminErweiterung
toxischer
Gewinn
von
Funktion
Verlust
von
Rezeptorfunktion
MotoneuronDegeneration
Andere neurodegenerative Krankheiten werden
durch Polyglutamin-Erweiterungen ausgelöst
• Huntingtonsche Krankheit
• Spinozerebelläre Ataxien
(SCAs)
• Kennedy-Syndrom (SBMA)
Polyglutamin-Erweiterungs-Krankheiten
werden verursacht durch toxische Proteine
• Die mutierten Proteine sind giftig in
Zellkulturen und Tiermodellen
• Die mutierten Proteine bilden Einschlüsse in
Neuronen
• Die mutierten Proteine bilden Aggregate mit
steigender Repeat-Länge
Alter SBMA-Beginn (a)
60
45
30
15
Zeit zum Aggregieren (h)
40
50
60
70
80
70
80
Repeatlänge
60
45
30
15
40
50
60
Repeatlänge
Giftigkeit mutierter Polyglutamine in
Zellkulturen
• Repeatlängen abhängig
• Größer mit nuklearer Lokalisation
*(Ansammlung bzw. Konzentration im Nukleus = Zellkern)
• Assoziiert mit der Aktivierung von
Zelltod-Signalwegen (*Apoptose)
*Unter Apoptose versteht man eine Form des Physiologischen Zelltods,
der von einer biologischen Zelle selbst durchgeführt wird. Siehe auch unter
Fachbegriffe
Mutierter AR sondert CBP ab, einen
kritischen Faktor für den Zellkern
CBP
CBP + mutierter
Androgenrezeptor
Taylor & Fischbeck, 2002
Veränderte Acetylierungshypothese
Mutiertes Polyglutamin verringert CBP und andere
Acetylasen, verursacht abnehmende Proteinacetylierung,
veränderte Genexpression und neuronale Giftigkeit.
Normale
Genexpression
Ac
Ac
Ac
Ac
Deacetylasen
Acetylasen
Deacetylasen
Veränderte
Genexpression
Ac
Acetylasen
Neuronale
Toxizität
(Apoptose)
Erweitertes Polyglutamin
Mutierte Polyglutamin-Giftigkeit wird “gerettet”
durch einen Deacetylase-Hemmer (SAHA*)
ARNLS with SAHA
30%
% transfected cell death
25%
20%
15%
10%
5%
0%
AR15NLS
0 uM
0.4 uM
AR110NLS
2 uM
* SAHA = Suberoylanilidhydroxaminsäure
5 uM
10 uM
McCampbell et al, 2001
Distal spinale und bulbäre
Muskelatrophie mit Stimmfaltenlähmung:
Ein Kennedy-Syndrom Doppelgänger?
§ autosomal dominant (befällt Männer & Frauen)
§ Ausbruch in 30ern mit Problemen. Flüssigkeiten zu
schlucken
§ Gesichtsschwäche und später Schwäche und Atrophie in
Händen > Füßen
§ Verursacht durch Mutation im Dynactin* (* ein Motorprotein)
Dynactin und axonaler Transport
Axon
• Nervenzellen hängen ab von Dynactin und Dynein,
um Stoffe entlang des Axons zu transportieren
• Mäuse mit Dynactin- und Dynein-Mutation zeigen
langsam progressive Schwäche durch
Degeneration der Motoneuronen
La Monte et al, 2002
Dynactin
Dynein
Leichte Verkettung
Blase
p150
Spectrin
Starke Verkettung
Arp1
Microtubuli*
Mutationen in Dynein und Dynactin in Mäusen und Menschen
verursachen Motoneuron-Degeneration wie bei SBMA.
Dynactin-Mutation in MotoneuronKrankheiten: mögliche Mechanismen
• Fehler der trophischen Meldungen (e.g.,
VEGF, IGF1, GDNF) die durch axonalen
Transport übertragen werden
• veränderte Bewegung anderen Materials
in Axonen (axonaler Verkehrsstau)
Androgenrezeptoren mit verlängertem
Polyglutamine-Trakt bilden Aggregate,
die den axonalen Verkehrsfluss und die
mitochondriale Verteilung in motoneuronalen Prozessen verändern
Piccioni F, Pinton P, Simeoni S, Pozzi P, Fascio U, Vismara G,
Martini L, Rizzuto R, Poletti A.
FASEB J. Sept 2002
Polyglutamin Erkrankungen:
NINDS Arzneimittel Screening
• 1040 Medikamente, überwiegend für
klinischen Einsatz freigegeben
• 29 Prüfungen bezogen auf
neurodegenerative Krankheiten
• 14 Polyglutamin-Prüfungen: zellfreie
Aggregation, Zellkulturen, Würmer,
Fliegen
• “Treffer” als Instrument für weitere Studien
der Krankheitsmechanismen und
mögliche Hinweise für eine therapeutische
Entwicklung
% CASPASE 3 INHIBITION
“Screen”, um Hemmstoffe von polyglutamineinduziertem Zelltod zu identifizieren
100
50
0
0
100
200
300
400
500
600
700
800
900
1000
-50
-100
1040 DRUGS
Piccioni et al, 2004
% CASPASE 3 INHIBITION
“Screen”, um Hemmstoffe von polyglutamineinduziertem Zelltod zu identifizieren
100
2 SD
50
0
0
100
200
300
400
500
600
700
800
900
1000
-50
-100
1040 DRUGS
Piccioni et al, 2004
Treffer Präparate
Nerifolin (cardiac glycoside)
Anisomycin (antiprotozoal)
Peruvoside (cardiac glycoside)
Prochlorperazine Edisylate
(antipsychotic)
Digitoxin (cardiac glycoside)
Calcimycin (calcium ionophore)
Pyrithione Zinc (antifungal)
Patulin (antibacterial)
Alexidine Hydrochloride
(antibacterial)
Lasalocid Sodium (antibiotic)
Strophanthidin (cardiac glycoside)
Suloctidil (vasodilator)
Phenylmercuric Acetate (fungicide)
Terfenadine (antihistamine)
Tyrothricin (topical antibacterial)
Sanguinarine Nitrate (antibacterial)
Celastrol (anti-inflammatory)
Gambogic Acid (antibacterial)
Lanatoside C (cardiac glycoside)
Gentian Violet (antibacterial)
Treffer Präparate
Nerifolin (cardiac glycoside)
Anisomycin (antiprotozoal)
Peruvoside (cardiac glycoside)
Prochlorperazine Edisylate
(antipsychotic)
Digitoxin (cardiac glycoside)
Calcimycin (calcium ionophore)
Pyrithione Zinc (antifungal)
Patulin (antibacterial)
Alexidine Hydrochloride
(antibacterial)
Lasalocid Sodium (antibiotic)
Strophanthidin (cardiac glycoside)
Suloctidil (vasodilator)
Phenylmercuric Acetate (fungicide)
Terfenadine (antihistamine)
Tyrothricin (topical antibacterial)
Sanguinarine Nitrate (antibacterial)
Celastrol (anti-inflammatory)
Gambogic Acid (antibacterial)
Lanatoside C (cardiac glycoside)
Gentian Violet (antibacterial)
Treffer Präparate
Nerifolin (cardiac glycoside)
Anisomycin (antiprotozoal)
Peruvoside (cardiac glycoside)
Prochlorperazine Edisylate
(antipsychotic)
Digitoxin (cardiac glycoside)
Calcimycin (calcium ionophore)
Pyrithione Zinc (antifungal)
Patulin (antibacterial)
Alexidine Hydrochloride
(antibacterial)
Lasalocid Sodium (antibiotic)
Strophanthidin (cardiac glycoside)
Suloctidil (vasodilator)
Phenylmercuric Acetate (fungicide)
Terfenadine (antihistamine)
Tyrothricin (topical antibacterial)
Sanguinarine Nitrate (antibacterial)
Celastrol (anti-inflammatory)
Gambogic Acid (antibacterial)
Lanatoside C (cardiac glycoside)
Gentian Violet (antibacterial)
Kennedy-Syndrom:
Androgenabhängige Giftigkeit
• Die Giftigkeit mutierter
Androgenrezeptoren ist bei Fliegen und
Mäusen androgen-abhängig
• Anti-androgen (Leuprolide) Behandlung
blockiert den Ausbruch der Krankheit und
bildet motorische Defizite bei Mäusen
zurück
Kennedy-Syndrom:
Therapeutische Möglichkeiten
• Deacetylase-Hemmer:
SAHA, Henylbutyrate
• Neurotrophische Faktoren:
VEGF, IGF1, GDNF
• Arzneimittel-Screenings:
Cardiac Glycoside, Celastrol
• Anti-Androgene:
Leuprolide, Finasteride, Dutasteride
Document
Kategorie
Gesundheitswesen
Seitenansichten
5
Dateigröße
439 KB
Tags
1/--Seiten
melden